DisGeNET - a database of gene-disease associations

Source: GWASDB

Variants associated to the Disease: Amyotrophic Lateral Sclerosis ×

Variants associated to the Gene: C9orf72 ×

Results per page

Gene

Disease

Variant

Source

DSI _v

DPI _v

pLI

Consequence

AF_EXOME

AF_GENOME

Variant	Gene	DSI _v	DPI _v	Chr	Position	Consequence	Alleles	Class	AF EXOME	AF GENOME	Num. diseases
rs3849942	C9orf72 ; LOC107987057	0.776	0.200	9	27543283	non coding transcript exon variant	T/A;C	snv			2
rs2814707	LOC112268043 ; C9orf72 ; LOC107987057	0.882	0.120	9	27536399	non coding transcript exon variant	C/G;T	snv			2
rs10122902	C9orf72	1.000	0.080	9	27556782	synonymous variant	G/A	snv	0.24	0.21	1
rs10757665	C9orf72	1.000	0.080	9	27557921	intron variant	T/C	snv		0.20	1
rs12349820	C9orf72	1.000	0.080	9	27553878	intron variant	T/C	snv		0.20	1
rs1565948	C9orf72	1.000	0.080	9	27559735	non coding transcript exon variant	G/A	snv		0.43	1
rs2282240	C9orf72	1.000	0.080	9	27572636	intron variant	C/T	snv		0.23	1
rs2282241	C9orf72	1.000	0.080	9	27572257	intron variant	C/A	snv		0.38	1
rs60242496	C9orf72	1.000	0.080	9	27572636	intron variant	-/GGAAAGTGCAGGACCTCCCTCCTG	delins			1
rs774357	C9orf72	1.000	0.080	9	27559837	non coding transcript exon variant	G/A	snv		0.21	1
rs774359	C9orf72	1.000	0.080	9	27561051	3 prime UTR variant	T/C	snv		0.23	1
rs10812611	LOC107987057 ; C9orf72	1.000	0.080	9	27542263	non coding transcript exon variant	C/T	snv		0.42	1
rs10967976	LOC107987057 ; C9orf72	1.000	0.080	9	27544945	intron variant	G/A;C	snv			1