Variant Gene DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1043679457
rs1043679457
0.752 0.400 5 60927745 intron variant C/A;G;T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs387907144
rs387907144
0.716 0.600 6 157181056 stop gained C/A;T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 2 2012 2015
dbSNP: rs886039777
rs886039777
0.925 0.120 21 33549517 stop gained C/T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 1 2016 2016
dbSNP: rs1010184002
rs1010184002
0.689 0.400 6 42978878 stop gained C/T snv 7.0E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1164484724
rs1164484724
0.790 0.240 9 137108433 stop gained C/T snv 7.0E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs121912854
rs121912854
0.851 0.200 3 48592915 stop gained G/A snv 1.2E-05 7.0E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555038111
rs1555038111
0.701 0.480 11 118478153 stop gained T/G snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555307370
rs1555307370
0.882 0.160 12 23740986 stop gained G/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555377415
rs1555377415
0.827 0.200 14 77027274 stop gained G/C snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555580263
rs1555580263
0.827 0.240 17 63837200 stop gained -/AGGTAGAACCTTATCTGCCATCTTC delins
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1555740650
rs1555740650
0.807 0.240 19 49596253 stop gained G/T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs1557781252
rs1557781252
0.742 0.320 1 153816414 stop gained G/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs267606826
rs267606826
0.708 0.520 14 28767903 stop gained C/A;G;T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs35135520
rs35135520
0.827 0.200 19 39480879 stop gained C/A;G;T snv 3.1E-03; 4.6E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs370244148
rs370244148
0.882 0.160 1 112514896 stop gained C/A;T snv 1.6E-05; 1.2E-05
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs374052333
rs374052333
0.763 0.320 3 132671032 stop gained C/G;T snv 4.0E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs398124401
rs398124401
0.695 0.480 4 55346393 stop gained G/A snv 1.2E-04 2.8E-05
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs730882242
rs730882242
0.807 0.280 5 141573518 stop gained G/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs776019250
rs776019250
0.827 0.200 19 39482885 stop gained G/C;T snv 4.0E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs794727774
rs794727774
0.827 0.240 1 23848684 stop gained C/T snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs80358263
rs80358263
0.827 0.280 14 74486378 stop gained G/T snv 8.4E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs863224880
rs863224880
0.925 0.160 11 68906074 stop gained G/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs869312713
rs869312713
0.882 0.320 16 89280070 stop gained C/A snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 0
dbSNP: rs397507545
rs397507545
0.708 0.560 12 112489083 missense variant G/A;C snv 4.0E-06
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 4 2003 2006
dbSNP: rs104894366
rs104894366
0.776 0.400 12 25245284 missense variant G/A;C snv
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
0.700 1.000 3 2006 2011