Variant Gene DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1568925507
rs1568925507
1.000 20 63438654 inframe insertion -/TCAAAGTGCTTCTGCCTGTGCTGCTCCTGAACCTTC delins
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs1060499733
rs1060499733
0.851 0.120 3 47846757 missense variant A/G snv
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs869320624
rs869320624
0.776 0.400 1 19220814 frameshift variant AAGG/- delins 1.4E-05
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 1.000 2 2016 2017
dbSNP: rs267606826
rs267606826
0.708 0.520 14 28767903 stop gained C/A;G;T snv
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs1202430946
rs1202430946
0.827 0.080 11 68930251 non coding transcript exon variant C/A;T snv 1.4E-05
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs267606670
rs267606670
0.790 0.320 19 41968837 missense variant C/A;T snv
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs794727792
rs794727792
0.827 0.120 9 127661140 stop gained C/A;T snv 4.0E-06
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs1131692231
rs1131692231
0.827 0.280 5 157294834 missense variant C/T snv
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs1555630216
rs1555630216
0.790 0.160 18 10714931 splice acceptor variant C/T snv
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs1555648288
rs1555648288
0.790 0.160 18 10795003 splice acceptor variant C/T snv
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs368869806
rs368869806
0.614 0.480 9 95485875 splice acceptor variant C/T snv 4.0E-06 7.0E-06
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs77078070
rs77078070
0.742 0.280 7 23165737 stop gained C/T snv 1.2E-05 1.4E-05
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs770374710
rs770374710
0.611 0.560 15 23645747 frameshift variant G/-;GG delins
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs139455627
rs139455627
0.851 0.240 21 44531087 stop gained G/A snv 3.2E-04 2.7E-04
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 1.000 1 2016 2016
dbSNP: rs1064796765
rs1064796765
0.763 0.240 14 102002950 missense variant G/A snv
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs587784347
rs587784347
0.742 0.280 22 38113561 missense variant G/A snv 8.0E-06
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs730882246
rs730882246
0.807 0.200 14 74494329 missense variant G/A snv
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs1555968941
rs1555968941
0.752 0.280 12 2653847 missense variant G/A;C snv
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs200661329
rs200661329
0.708 0.440 16 576255 splice donor variant G/A;C snv 5.7E-05
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs1057524820
rs1057524820
0.776 0.280 12 51765746 missense variant G/A;T snv
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs114925667
rs114925667
0.672 0.520 3 132675903 missense variant G/A;T snv 1.9E-03; 4.1E-06
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs1569151872
rs1569151872
0.851 0.240 21 44509225 frameshift variant GAC/AA delins
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 1.000 1 2016 2016
dbSNP: rs1553770577
rs1553770577
0.724 0.480 3 132675342 missense variant T/C snv
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs1553621496
rs1553621496
0.677 0.440 2 209976305 splice donor variant T/G snv
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 0
dbSNP: rs1562846694
rs1562846694
0.763 0.320 7 100643252 inframe deletion TTCGCTCCACGCACT/- delins
CUI: C1853743
Disease: Muscular hypotonia of the trunk
Muscular hypotonia of the trunk
0.700 1.000 1 2019 2019