Source: ALL

Variant Gene DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs11166389
rs11166389
1.000 0.040 1 100000723 non coding transcript exon variant G/A snv 0.15
CUI: C0017638
Disease: Glioma
Glioma
0.700 1.000 1 2009 2009
dbSNP: rs11166389
rs11166389
1.000 0.040 1 100000723 non coding transcript exon variant G/A snv 0.15
CUI: C0085136
Disease: Central Nervous System Neoplasms
Central Nervous System Neoplasms
0.700 1.000 1 2009 2009
dbSNP: rs1014290
rs1014290
0.827 0.280 4 10000237 intron variant G/A snv 0.72
CUI: C0018099
Disease: Gout
Gout
0.810 1.000 6 2010 2019
dbSNP: rs1014290
rs1014290
0.827 0.280 4 10000237 intron variant G/A snv 0.72
CUI: C0003868
Disease: Arthritis, Gouty
Arthritis, Gouty
0.800 1.000 5 2010 2019
dbSNP: rs1014290
rs1014290
0.827 0.280 4 10000237 intron variant G/A snv 0.72
CUI: C0022650
Disease: Kidney Calculi
Kidney Calculi
0.010 1.000 1 2010 2010
dbSNP: rs1014290
rs1014290
0.827 0.280 4 10000237 intron variant G/A snv 0.72
CUI: C0392525
Disease: Nephrolithiasis
Nephrolithiasis
0.010 1.000 1 2010 2010
dbSNP: rs1014290
rs1014290
0.827 0.280 4 10000237 intron variant G/A snv 0.72
CUI: C0030567
Disease: Parkinson Disease
Parkinson Disease
0.010 1.000 1 2017 2017
dbSNP: rs1014290
rs1014290
0.827 0.280 4 10000237 intron variant G/A snv 0.72
CUI: C0202239
Disease: Uric acid measurement (procedure)
Uric acid measurement (procedure)
0.700 1.000 1 2009 2009
dbSNP: rs2403261
rs2403261
11 10000244 non coding transcript exon variant T/C snv 0.25
Corpuscular Hemoglobin Concentration Mean
0.700 1.000 1 2012 2012
dbSNP: rs7947224
rs7947224
1.000 0.040 11 100002678 intron variant T/C snv 0.39
CUI: C0003125
Disease: Anorexia Nervosa
Anorexia Nervosa
0.010 1.000 1 2009 2009
dbSNP: rs78154696
rs78154696
1.000 0.080 5 1000041 upstream gene variant G/A;T snv
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung
0.700 1.000 1 2017 2017
dbSNP: rs9833888
rs9833888
1.000 0.080 3 100004736 intron variant G/T snv 0.18
CUI: C0678222
Disease: Breast Carcinoma
Breast Carcinoma
0.700 1.000 1 2017 2017
dbSNP: rs1131692272
rs1131692272
0.851 0.240 2 100006808 missense variant C/T snv
CUI: C0410536
Disease: Mesomelic dysplasia
Mesomelic dysplasia
0.010 1.000 1 2019 2019
dbSNP: rs1131692272
rs1131692272
0.851 0.240 2 100006808 missense variant C/T snv
CUI: C0036572
Disease: Seizures
Seizures
0.700 0
dbSNP: rs1131692272
rs1131692272
0.851 0.240 2 100006808 missense variant C/T snv
CUI: C4021790
Disease: Abnormality of the skeletal system
Abnormality of the skeletal system
0.700 0
dbSNP: rs1131692272
rs1131692272
0.851 0.240 2 100006808 missense variant C/T snv
CUI: C0557874
Disease: Global developmental delay
Global developmental delay
0.700 0
dbSNP: rs1131692272
rs1131692272
0.851 0.240 2 100006808 missense variant C/T snv
CUI: C0424503
Disease: Dysmorphic facies
Dysmorphic facies
0.700 0
dbSNP: rs1131692272
rs1131692272
0.851 0.240 2 100006808 missense variant C/T snv
CUI: C0036857
Disease: Severe intellectual disability
Severe intellectual disability
0.700 0
dbSNP: rs1131692272
rs1131692272
0.851 0.240 2 100006808 missense variant C/T snv
Delayed speech and language development
0.700 0
dbSNP: rs1131692272
rs1131692272
0.851 0.240 2 100006808 missense variant C/T snv
CUI: C0349588
Disease: Short stature
Short stature
0.700 0
dbSNP: rs1131692272
rs1131692272
0.851 0.240 2 100006808 missense variant C/T snv
CUI: C1858120
Disease: Generalized hypotonia
Generalized hypotonia
0.700 0
dbSNP: rs7696895
rs7696895
0.925 0.120 4 10000801 intron variant T/C snv 0.24
CUI: C0018099
Disease: Gout
Gout
0.700 1.000 2 2010 2013
dbSNP: rs7696895
rs7696895
0.925 0.120 4 10000801 intron variant T/C snv 0.24
CUI: C0003868
Disease: Arthritis, Gouty
Arthritis, Gouty
0.700 1.000 2 2010 2013
dbSNP: rs7696895
rs7696895
0.925 0.120 4 10000801 intron variant T/C snv 0.24
CUI: C0202239
Disease: Uric acid measurement (procedure)
Uric acid measurement (procedure)
0.700 1.000 1 2009 2009
dbSNP: rs1565115957
rs1565115957
1.000 0.080 11 10000952 frameshift variant CAATAATGAAAGGCGTTGGGGAACTTAGAACTTCCAGTAGCTGAGCCGGGAGAATAGGGATATAAGGATA/- del
CUI: C4082197
Disease: Charcot-Marie-Tooth disease type 4
Charcot-Marie-Tooth disease type 4
0.700 0