Variant Gene DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs104893991
rs104893991
0.878 0.107 6 45438040 missense variant G/A snp
CUI: C0008928
Disease: Cleidocranial Dysplasia
Cleidocranial Dysplasia
0.810 1.000 7 1999 2018
dbSNP: rs104893990
rs104893990
0.878 0.107 6 45432011 missense variant G/A snp
CUI: C0008928
Disease: Cleidocranial Dysplasia
Cleidocranial Dysplasia
0.810 1.000 2 1997 1999
dbSNP: rs104893992
rs104893992
0.878 0.107 6 45438039 missense variant C/T snp
CUI: C0008928
Disease: Cleidocranial Dysplasia
Cleidocranial Dysplasia
0.800 5 1999 2017
dbSNP: rs104893989
rs104893989
0.878 0.107 6 45431963 missense variant T/C,G snp 2.0E-05
CUI: C0008928
Disease: Cleidocranial Dysplasia
Cleidocranial Dysplasia
0.800 3 1997 2018
dbSNP: rs104893995
rs104893995
0.878 0.107 6 45431945 missense variant G/A,C snp 4.0E-06
CUI: C0008928
Disease: Cleidocranial Dysplasia
Cleidocranial Dysplasia
0.800 3 1999 2003
dbSNP: rs104893993
rs104893993
0.878 0.107 6 45437964 missense variant A/G snp
CUI: C0008928
Disease: Cleidocranial Dysplasia
Cleidocranial Dysplasia
0.800 2 1993 1999
dbSNP: rs104893988
rs104893988
1.000 0.071 6 45512277 stop gained G/A snp
CUI: C0008928
Disease: Cleidocranial Dysplasia
Cleidocranial Dysplasia
0.700 1 1997 1997
dbSNP: rs104893994
rs104893994
1.000 0.071 6 45547304 stop lost G/C snp
CUI: C0008928
Disease: Cleidocranial Dysplasia
Cleidocranial Dysplasia
0.700 1 2002 2002
dbSNP: rs201647225
rs201647225
0.878 0.107 6 45431962 missense variant A/G snp 1.1E-04
CUI: C0008928
Disease: Cleidocranial Dysplasia
Cleidocranial Dysplasia
0.700 1 2010 2010
dbSNP: rs397515537
rs397515537
1.000 0.071 6 45546910 stop gained C/T snp
CUI: C0008928
Disease: Cleidocranial Dysplasia
Cleidocranial Dysplasia
0.700 1 1993 1993
dbSNP: rs397515538
rs397515538
1.000 0.071 6 45422624 frameshift variant C/CC in-del
CUI: C0008928
Disease: Cleidocranial Dysplasia
Cleidocranial Dysplasia
0.700 1 1993 1993
dbSNP: rs730880313
rs730880313
1.000 0.071 6 45422723 frameshift variant AGCAGCAACAGCAGCA/AACAGCAGCAGCAGCAGCAGCAACAGCAGCCG in-del
CUI: C0008928
Disease: Cleidocranial Dysplasia
Cleidocranial Dysplasia
0.700 1 1997 1997
dbSNP: rs730880315
rs730880315
1.000 0.071 6 45546967 frameshift variant C/CC in-del
CUI: C0008928
Disease: Cleidocranial Dysplasia
Cleidocranial Dysplasia
0.700 1 2005 2005
dbSNP: rs752933596
rs752933596
0.878 0.107 6 45438020 missense variant A/T snp
CUI: C0008928
Disease: Cleidocranial Dysplasia
Cleidocranial Dysplasia
0.700 1 2002 2002
dbSNP: rs864621970
rs864621970
1.000 0.071 6 45431915 missense variant G/A snp
CUI: C0008928
Disease: Cleidocranial Dysplasia
Cleidocranial Dysplasia
0.700 1 2016 2016