Source: CLINVAR

Variant Gene Disease Risk Allele Score vda Association Type Original DB Sentence supporting the association PMID PMID Year
dbSNP: rs80358232
rs80358232
Cardioencephalomyopathy, Fatal Infantile, due to Cytochrome C Oxidase Deficiency
A 0.800 CausalMutation CLINVAR

dbSNP: rs74315511
rs74315511
CUI: C1837148
Disease: MYOPIA 6 (disorder)
MYOPIA 6 (disorder)
T 0.800 CausalMutation CLINVAR

dbSNP: rs74315511
rs74315511
Cardioencephalomyopathy, Fatal Infantile, due to Cytochrome C Oxidase Deficiency
T 0.800 CausalMutation CLINVAR

dbSNP: rs28937868
rs28937868
Cardioencephalomyopathy, Fatal Infantile, due to Cytochrome C Oxidase Deficiency
T 0.800 CausalMutation CLINVAR

dbSNP: rs28937598
rs28937598
Cardioencephalomyopathy, Fatal Infantile, due to Cytochrome C Oxidase Deficiency
A 0.800 CausalMutation CLINVAR

dbSNP: rs786205097
rs786205097
Mitochondrial DNA Depletion Syndrome 1
AG 0.700 CausalMutation CLINVAR

dbSNP: rs761665644
rs761665644
CUI: C0031117
Disease: Peripheral Neuropathy
Peripheral Neuropathy
G 0.700 CausalMutation CLINVAR

dbSNP: rs761665644
rs761665644
CUI: C0262918
Disease: Extraocular Muscle Paresis
Extraocular Muscle Paresis
G 0.700 CausalMutation CLINVAR

dbSNP: rs761665644
rs761665644
CUI: C1836923
Disease: Gastrointestinal dysmotility
Gastrointestinal dysmotility
G 0.700 CausalMutation CLINVAR

dbSNP: rs761665644
rs761665644
Mitochondrial DNA Depletion Syndrome 1
G 0.700 CausalMutation CLINVAR

dbSNP: rs74315512
rs74315512
Cardioencephalomyopathy, Fatal Infantile, due to Cytochrome C Oxidase Deficiency
A 0.700 CausalMutation CLINVAR

dbSNP: rs74315511
rs74315511
CUI: C0036572
Disease: Seizures
Seizures
T 0.700 CausalMutation CLINVAR

dbSNP: rs74315511
rs74315511
CUI: C1837397
Disease: Severe global developmental delay
Severe global developmental delay
T 0.700 CausalMutation CLINVAR

dbSNP: rs74315510
rs74315510
CUI: C1837148
Disease: MYOPIA 6 (disorder)
MYOPIA 6 (disorder)
A 0.700 CausalMutation CLINVAR

dbSNP: rs74315510
rs74315510
Cardioencephalomyopathy, Fatal Infantile, due to Cytochrome C Oxidase Deficiency
A 0.700 CausalMutation CLINVAR

dbSNP: rs1556488264
rs1556488264
CUI: C0031117
Disease: Peripheral Neuropathy
Peripheral Neuropathy
C 0.700 CausalMutation CLINVAR

dbSNP: rs1556488264
rs1556488264
CUI: C0262918
Disease: Extraocular Muscle Paresis
Extraocular Muscle Paresis
C 0.700 CausalMutation CLINVAR

dbSNP: rs1556488264
rs1556488264
CUI: C1836923
Disease: Gastrointestinal dysmotility
Gastrointestinal dysmotility
C 0.700 CausalMutation CLINVAR

dbSNP: rs1556488264
rs1556488264
Mitochondrial DNA Depletion Syndrome 1
C 0.700 CausalMutation CLINVAR

dbSNP: rs1556486107
rs1556486107
Mitochondrial DNA Depletion Syndrome 1
GC 0.700 CausalMutation CLINVAR

dbSNP: rs1471478620
rs1471478620
Mitochondrial DNA Depletion Syndrome 1
AG 0.700 GeneticVariation CLINVAR

dbSNP: rs121913039
rs121913039
Mitochondrial DNA Depletion Syndrome 1
T 0.700 GeneticVariation CLINVAR

dbSNP: rs121908508
rs121908508
Cardioencephalomyopathy, Fatal Infantile, due to Cytochrome C Oxidase Deficiency
T 0.700 CausalMutation CLINVAR

dbSNP: rs1064792875
rs1064792875
Mitochondrial DNA Depletion Syndrome 1
T 0.700 CausalMutation CLINVAR

dbSNP: rs749838192
rs749838192
CUI: C0007193
Disease: Cardiomyopathy, Dilated
Cardiomyopathy, Dilated
CTGAGTCACTGCTGCATGCT 0.700 GeneticVariation CLINVAR A novel mutation in the SCO2 gene in a neonate with early-onset cardioencephalomyopathy. 20159436

2010