HER2 is a member of the epidermal growth factor family, which is overexpressed in breast, ovarian, gastric, colorectal, pancreatic, and endometrial cancers in a stratified manner.
HER2 or ErbB2 is a member of the epidermal growth factor family and is overexpressed in subsets of breast, ovarian, gastric, colorectal, pancreatic, and endometrial cancers.
For the EGF gene, no association emerged between common genetic variants and endometrial cancer risk or myometrial invasion, but we found a five-tagSNP region that covered 51 kb at the 5' end of the gene where all five tagSNPs seemed to decrease the risk of dying from endometrial cancer.
Immunohistochemistry was used to investigate the expression of GPR30, estrogen, progesterone, epidermal growth factor receptors and Ki-67 in 47 consecutive consenting patients with endometrial carcinoma diagnosed between 1997 and 2001.
We describe the expression of the four receptors, HER1, HER2, HER3, HER4 and the six ligands amphiregulin, transforming growth factor alpha (TGF-alpha), heparin binding EGF like growth factor (HB-EGF), betacellulin, epiregulin and EGF in endometrioid endometrial cancer.
Epidermal growth factor (EGF) and transforming growth factor-alpha (TGF-alpha) upregulated survivin protein expression by activating the MAPK pathway in endometrial cancer cells.
The mouse lactoferrin gene promoter includes a CAAT/GT box, GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95).
Taken together, these results suggest that mutated K-ras causes a loss of responsiveness to EGF stimulation and that EGFR function is dispensable for the growth of mutant Ras-positive endometrial carcinoma cells.
We found that the CRE and noncanonical TATA box (ATAAA) are the minimal promoter elements for basal activity of the chloramphenicol acetyltransferase (CAT) reporter construct whereas the EGFRE is needed for an additional activity induced by EGF in transiently transfected human endometrial carcinoma RL95-2 cells (RL95-2).
The effects of the transforming growth factor-beta 1 (TGF-beta 1) and epidermal growth factor (EGF) on the growth of cells from 2 endometrial cancer lines, Ishikawa and HEC-50 were evaluated by measuring rates of DNA synthesis and changes in cell numbers during culture.