Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs587778792
rs587778792
SHH
2 0.925 0.120 7 155811823 missense variant C/G snv 0.710 1.000 1 2005 2005
dbSNP: rs587778799
rs587778799
SHH
2 0.925 0.120 7 155806296 missense variant C/G snv 0.710 1.000 1 2005 2005
dbSNP: rs104894040
rs104894040
SHH
4 0.882 0.160 7 155806509 missense variant A/C;G snv 0.700 0
dbSNP: rs104894042
rs104894042
SHH
2 0.925 0.120 7 155803618 missense variant A/T snv 0.700 0
dbSNP: rs104894043
rs104894043
SHH
2 0.925 0.120 7 155803613 missense variant C/T snv 4.4E-05 5.6E-05 0.700 0
dbSNP: rs104894044
rs104894044
SHH
2 0.925 0.120 7 155811825 stop gained G/A snv 0.700 0
dbSNP: rs104894045
rs104894045
SHH
2 0.925 0.120 7 155806545 stop gained T/A snv 0.700 0
dbSNP: rs104894046
rs104894046
SHH
2 0.925 0.120 7 155803439 stop gained C/A;T snv 1.5E-05 0.700 0
dbSNP: rs104894048
rs104894048
SHH
2 0.925 0.120 7 155803019 missense variant G/C;T snv 3.7E-05 0.700 0
dbSNP: rs104894050
rs104894050
SHH
2 0.925 0.120 7 155811860 missense variant T/A snv 0.700 0
dbSNP: rs104894051
rs104894051
SHH
2 0.925 0.120 7 155803523 stop gained C/A;G snv 1.5E-05 0.700 0
dbSNP: rs139565972
rs139565972
1 1.000 0.120 10 101770595 missense variant C/A;T snv 6.0E-05 7.7E-05 0.700 0
dbSNP: rs146990376
rs146990376
SHH
1 1.000 0.120 7 155806384 stop gained G/A;C snv 1.2E-05 0.700 0
dbSNP: rs1490604080
rs1490604080
1 1.000 0.120 10 101771462 splice donor variant C/T snv 0.700 0
dbSNP: rs1554834321
rs1554834321
1 1.000 0.120 10 101770491 inframe deletion GCCGGCCCTTGCGGG/- delins 0.700 0
dbSNP: rs1554834889
rs1554834889
1 1.000 0.120 10 101774912 missense variant C/G snv 0.700 0
dbSNP: rs1554834892
rs1554834892
1 1.000 0.120 10 101774913 splice acceptor variant C/T snv 0.700 0
dbSNP: rs1557612048
rs1557612048
11 0.807 0.200 1 26767868 missense variant T/C snv 0.700 0
dbSNP: rs267607047
rs267607047
SHH
2 0.925 0.120 7 155806513 missense variant G/A;T snv 4.0E-06 0.700 0
dbSNP: rs28936675
rs28936675
SHH
2 0.925 0.120 7 155812032 missense variant C/T snv 0.700 0
dbSNP: rs397515364
rs397515364
2 0.925 0.120 13 99985400 frameshift variant -/C delins 0.700 0
dbSNP: rs397515365
rs397515365
2 0.925 0.120 13 99983104 frameshift variant GAGAACC/- delins 0.700 0
dbSNP: rs397515375
rs397515375
SHH
2 0.925 0.120 7 155803481 inframe deletion GCGGCGGTGAGCAGCAGGCGC/- delins 0.700 0
dbSNP: rs397515376
rs397515376
SHH
2 0.925 0.120 7 155803149 inframe deletion GCGCGAAGG/- delins 0.700 0
dbSNP: rs528376963
rs528376963
1 1.000 0.120 8 38424565 missense variant C/T snv 4.0E-06 0.700 0