Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs137852741
rs137852741
5 0.846 0.107 2 202556360 stop gained C/G,T snp 4.0E-06 0.700 13 2000 2017
dbSNP: rs137852746
rs137852746
5 0.821 0.071 2 202552773 stop gained C/T snp 0.700 12 1988 2016
dbSNP: rs137852753
rs137852753
2 0.923 0.071 2 202518831 stop gained C/T snp 0.700 11 2001 2017
dbSNP: rs869025366
rs869025366
1 1.000 0.071 2 202513739 stop gained C/T snp 4.0E-06 0.700 11 2001 2016
dbSNP: rs137852749
rs137852749
5 0.821 0.071 2 202552774 missense variant G/A snp 0.700 10 1988 2016
dbSNP: rs137852751
rs137852751
1 1.000 0.071 2 202530820 stop gained C/T snp 0.700 9 2001 2016
dbSNP: rs137852748
rs137852748
1 1.000 0.071 2 202556282 stop gained C/T snp 0.700 8 2000 2016
dbSNP: rs1060502581
rs1060502581
1 1.000 0.071 2 202520195 stop gained C/T snp 0.700 7 2004 2017
dbSNP: rs1085307254
rs1085307254
1 1.000 0.071 2 202518927 missense variant G/A,C,T snp 0.700 6 2001 2016
dbSNP: rs1085307395
rs1085307395
1 1.000 0.071 2 202556245 frameshift variant TT/T in-del 0.700 6 2000 2016
dbSNP: rs1085307154
rs1085307154
1 1.000 0.071 2 202377522 stop gained G/A snp 0.700 5 2008 2017
dbSNP: rs1085307177
rs1085307177
1 1.000 0.071 2 202464932 missense variant A/G snp 0.700 5 2004 2016
dbSNP: rs1085307325
rs1085307325
1 1.000 0.071 2 202532715 missense variant G/A snp 0.700 5 2004 2016
dbSNP: rs1085307346
rs1085307346
1 1.000 0.071 2 202542431 stop gained G/A snp 0.700 5 2004 2016
dbSNP: rs748230358
rs748230358
1 1.000 0.071 2 202532582 splice region variant C/G,T snp 4.0E-06; 8.0E-06 0.700 5 2001 2016
dbSNP: rs863223420
rs863223420
1 1.000 0.071 2 202530955 splice donor variant G/A,C,T snp 0.700 5 2003 2016
dbSNP: rs863223426
rs863223426
1 1.000 0.071 2 202467648 missense variant A/G snp 0.700 5 2009 2016
dbSNP: rs886041324
rs886041324
1 1.000 0.071 2 202518837 stop gained C/T snp 0.700 5 2004 2016
dbSNP: rs946132834
rs946132834
1 1.000 0.071 2 202532663 stop gained C/T snp 0.700 5 2002 2016
dbSNP: rs1085307174
rs1085307174
1 1.000 0.071 2 202464921 inframe deletion GTAGCACCTGCTATGGCCTTTG/G in-del 0.700 4 2006 2016
dbSNP: rs1085307184
rs1085307184
1 1.000 0.071 2 202464976 stop gained C/T snp 0.700 4 2003 2016
dbSNP: rs1085307211
rs1085307211
1 1.000 0.071 2 202467610 stop gained C/A,G snp 0.700 4 2008 2016
dbSNP: rs1085307215
rs1085307215
1 1.000 0.071 2 202467621 missense variant G/A,C snp 0.700 4 2001 2016
dbSNP: rs1085307248
rs1085307248
1 1.000 0.071 2 202518859 frameshift variant G/GG in-del 0.700 4 2006 2016
dbSNP: rs1085307297
rs1085307297
1 1.000 0.071 2 202530927 frameshift variant GGGAGG/G in-del 0.700 4 2000 2016