Source: ALL
Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs61752717
rs61752717
72 0.583 0.840 16 3243407 missense variant T/A;C snv 2.8E-04 0.020 1.000 2 2012 2015
dbSNP: rs116840789
rs116840789
6 0.925 0.080 3 8745547 missense variant G/A;T snv 0.010 1.000 1 2000 2000
dbSNP: rs1187636039
rs1187636039
5 0.925 0.120 3 89341043 missense variant C/A snv 0.010 1.000 1 2011 2011
dbSNP: rs147080557
rs147080557
6 0.882 0.120 19 53810777 missense variant G/A;C snv 3.6E-05; 4.0E-06 0.010 1.000 1 2011 2011
dbSNP: rs2249492
rs2249492
2 1.000 0.040 17 50185660 intron variant C/G;T snv 0.59 0.010 1.000 1 2018 2018
dbSNP: rs2306283
rs2306283
16 0.742 0.320 12 21176804 missense variant A/G;T snv 0.47 0.010 1.000 1 2012 2012
dbSNP: rs759411064
rs759411064
2 3 49530915 missense variant C/G snv 4.0E-06 0.010 1.000 1 2000 2000
dbSNP: rs1555876283
rs1555876283
5 0.925 0.080 20 45416526 frameshift variant A/- del 0.700 0
dbSNP: rs1569548274
rs1569548274
43 0.701 0.520 X 154030553 splice acceptor variant TCCAGTGAGCCTCCTCTGGGCATCTTCTCCTCTTTGCAGACGCTGCTGCTCAAGTCCTGGGGCTCAGGGGGGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGTGGGAGCAGTGGCACGGGGGCCTTTGGGGACTCTGAGTGGTGGTGATGGTGGTGGTGCTCCTTCTTGGGGGGTGAGGAGGCGCTGCTGCTGCGCCCCTTGGGGCTGCTCTCCTTGCTTTTCCGCCCAGGGCTCTTACAGGTCTTCAGTCCTTTCCCGCTCTTCTCACCGAGGGTGGACACCAGCAGGGGCTTCACCACTTCCTTGACCTCGATGCTGACCGTCTCCCGGGTCTTGCGCTTCTTGATGGGGAGTACGGTCTCCTGCACAGATCGGATAGAAGACTCCTTCACGGCTTTCTTTTTGGCCTCGGCGGCAGCGGCTGCCACCACACTCCCCGGCTTTCGGCCCCGTTTCTTGGGAATGGCCTGAGGGTCGGCCTCAGCTTTTCGCTTCCTGCCGGGGCGTTTGATCACCATGACCTGGGTGGATGTGGTGGCCCCACCCCCCTCAGC/- delins 0.700 0
dbSNP: rs878855327
rs878855327
5 0.925 0.280 16 89279750 frameshift variant G/-;GG delins 0.700 0
dbSNP: rs1263071018
rs1263071018
2 3 8745821 missense variant G/C snv 7.0E-06 0.010 1.000 1 2000 2000
dbSNP: rs121918459
rs121918459
47 0.662 0.440 12 112450368 missense variant A/G snv 1.2E-05 7.0E-06 0.700 0
dbSNP: rs776974834
rs776974834
6 0.882 0.160 20 45420215 frameshift variant AAAG/- delins 1.2E-05 7.0E-06 0.700 0
dbSNP: rs398123383
rs398123383
4 1.000 0.120 6 129460287 stop gained C/T snv 1.6E-05 7.0E-06 0.700 0
dbSNP: rs1048379601
rs1048379601
DMD
2 X 31773986 missense variant T/C snv 1.9E-05 0.010 1.000 1 2000 2000
dbSNP: rs781565158
rs781565158
22 0.851 0.120 12 21452130 missense variant A/G snv 4.7E-05 2.1E-05 0.700 0
dbSNP: rs138977195
rs138977195
5 1.000 0.120 16 56887967 missense variant G/A snv 3.7E-04 4.1E-04 0.700 0
dbSNP: rs4149056
rs4149056
45 0.633 0.480 12 21178615 missense variant T/C snv 0.13 0.12 0.020 1.000 2 2012 2013
dbSNP: rs1800012
rs1800012
13 0.763 0.320 17 50200388 intron variant C/A snv 0.14 0.010 1.000 1 2018 2018
dbSNP: rs4363657
rs4363657
5 12 21215788 intron variant T/C snv 0.18 0.010 1.000 1 2015 2015
dbSNP: rs12722
rs12722
6 0.882 0.120 9 134842570 3 prime UTR variant C/T snv 0.44 0.010 1.000 1 2018 2018
dbSNP: rs7924316
rs7924316
1 11 2152217 intron variant T/G snv 0.50 0.010 1.000 1 2007 2007