Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1064795559
rs1064795559
29 0.752 0.320 22 30946373 missense variant G/A snv 0.700 0
dbSNP: rs114925667
rs114925667
64 0.672 0.520 3 132675903 missense variant G/A;T snv 1.9E-03; 4.1E-06 0.700 0
dbSNP: rs121918467
rs121918467
23 0.807 0.280 12 112486482 missense variant C/A;T snv 8.0E-06; 1.2E-05 0.700 0
dbSNP: rs1553770577
rs1553770577
37 0.724 0.480 3 132675342 missense variant T/C snv 0.700 0
dbSNP: rs1560755661
rs1560755661
44 0.701 0.480 4 106171094 splice donor variant CAGATCTGTCTTTGGAGGATCTGGACACTCAGCAGAGAAATAAGGTGCCGAACTTCTGCCTCCACTGCTGTCAGAAGATGGCTTTGGAGGTTGAGCATGCTGTCTGTAAGTAGCACTTTTAGGAGTCCAACAAAACAGGTTGATAGATTCTCTCACACAGCGTTCAATGTCAATTTC/- delins 0.700 0
dbSNP: rs61816761
rs61816761
43 0.658 0.640 1 152313385 stop gained G/A;T snv 9.4E-03; 8.0E-06 0.700 0
dbSNP: rs1064795104
rs1064795104
17 0.790 0.440 2 72498492 stop gained A/C snv 0.700 1.000 2 2013 2014
dbSNP: rs1060499548
rs1060499548
27 0.724 0.440 9 130872961 missense variant G/A snv 0.700 1.000 1 2017 2017
dbSNP: rs587777736
rs587777736
5 0.882 0.240 9 136517908 missense variant A/G snv 0.700 1.000 1 2014 2014