Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs587780024
rs587780024
3 0.923 0.179 2 214730457 frameshift variant T/TCATACTTTTCTTCCTGTTCA in-del 6.4E-05 3.2E-05 0.700 10 2007 2017
dbSNP: rs587780021
rs587780021
4 0.878 0.179 2 214745842 stop gained G/A snp 2.4E-05 3.2E-05 0.700 8 2012 2017
dbSNP: rs730881422
rs730881422
2 1.000 0.071 2 214730416 stop gained G/A snp 0.700 6 2007 2017
dbSNP: rs587781707
rs587781707
3 1.000 0.071 2 214752472 stop gained G/A,C snp 1.2E-05 0.700 5 2015 2017
dbSNP: rs587781948
rs587781948
3 0.923 0.071 2 214730491 stop gained G/A snp 1.6E-05 3.2E-05 0.700 4 2013 2017
dbSNP: rs786201912
rs786201912
2 1.000 0.071 2 214792363 stop gained G/A snp 4.0E-06 0.700 4 2010 2017
dbSNP: rs879254139
rs879254139
3 0.923 0.179 2 214797118 splice acceptor variant C/A snp 0.700 4 2010 2017
dbSNP: rs587780033
rs587780033
2 1.000 0.071 2 214781250 frameshift variant C/CT in-del 8.7E-06 0.700 3 2015 2017
dbSNP: rs587782504
rs587782504
2 1.000 0.071 2 214730479 frameshift variant CAT/C in-del 3.2E-05 0.700 3 2015 2017
dbSNP: rs753785671
rs753785671
2 1.000 0.071 2 214780559 splice donor variant C/T snp 4.0E-06 0.700 3 2010 2017
dbSNP: rs758972589
rs758972589
2 1.000 0.071 2 214792327 stop gained G/A snp 8.0E-06 0.700 3 2013 2017
dbSNP: rs864622223
rs864622223
2 1.000 0.071 2 214781246 frameshift variant GTT/G in-del 4.3E-06 0.700 3 2015 2017
dbSNP: rs1057517589
rs1057517589
2 1.000 0.071 2 214797099 frameshift variant GCT/G in-del 0.700 2 2015 2017
dbSNP: rs28997576
rs28997576
8 0.784 0.143 2 214752454 missense variant C/G,T snp 1.5E-02 1.4E-02 0.020 1.000 2 2006 2012
dbSNP: rs1045485
rs1045485
26 0.652 0.393 2 201284866 missense variant G/A,C,T snp 4.0E-06; 9.0E-02 3.2E-05; 9.8E-02 0.010 1.000 1 2006 2006
dbSNP: rs1060501287
rs1060501287
1 1.000 0.071 2 214769302 frameshift variant AG/A in-del 0.700 1 2017 2017
dbSNP: rs1060501291
rs1060501291
1 1.000 0.071 2 214780940 missense variant T/G snp 0.700 1 2017 2017
dbSNP: rs1060501310
rs1060501310
1 1.000 0.071 2 214752446 splice donor variant C/G,T snp 4.0E-06 0.700 1 2017 2017
dbSNP: rs1064792931
rs1064792931
1 1.000 0.071 2 214752490 frameshift variant TAGCAGCAATAGCGATTTCATACTTTCATCATCTGT/TCGC in-del 0.700 1 2017 2017
dbSNP: rs13010627
rs13010627
10 0.756 0.321 2 201209375 missense variant G/A snp 4.2E-02 4.5E-02 0.010 1.000 1 2006 2006
dbSNP: rs13387042
rs13387042
10 0.769 0.179 2 217041109 intergenic variant A/G snp 0.44 0.010 1.000 1 2013 2013
dbSNP: rs2070094
rs2070094
3 0.878 0.071 2 214767531 missense variant C/A,T snp 1.6E-05; 0.37 9.6E-05; 0.38 0.010 1.000 1 2006 2006
dbSNP: rs377153250
rs377153250
2 1.000 0.071 2 214780658 stop gained G/A,C snp 1.6E-05; 4.0E-06 3.2E-05 0.700 1 2017 2017
dbSNP: rs386654966
rs386654966
3 0.878 0.071 2 214767531 missense variant CA/AG,TG multinucleotide-polymorphism 0.010 1.000 1 2006 2006
dbSNP: rs587782122
rs587782122
1 1.000 0.071 2 214752452 missense variant A/G,T snp 2.4E-05; 8.0E-06 0.010 1.000 1 2006 2006