Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs113994095
rs113994095
31 0.701 0.360 15 89327201 missense variant C/T snv 5.1E-04 6.7E-04 0.700 1.000 41 2001 2018
dbSNP: rs869320624
rs869320624
13 0.776 0.400 1 19220814 frameshift variant AAGG/- delins 1.4E-05 0.700 1.000 2 2016 2017
dbSNP: rs1555817157
rs1555817157
16 0.742 0.280 20 25339320 frameshift variant TCTTCCTCAGGCG/- del 0.700 1.000 1 2018 2018
dbSNP: rs374997012
rs374997012
9 0.851 0.280 10 100989114 missense variant C/T snv 8.0E-06 7.0E-06 0.700 1.000 1 2016 2016
dbSNP: rs886037832
rs886037832
9 0.851 0.280 10 100988541 frameshift variant T/- delins 0.700 1.000 1 2016 2016
dbSNP: rs121908188
rs121908188
25 0.742 0.360 1 25809753 missense variant G/A;C snv 1.8E-04 0.700 0
dbSNP: rs1559931177
rs1559931177
34 0.827 0.120 3 49047207 stop gained G/A snv 0.700 0
dbSNP: rs1560755661
rs1560755661
44 0.701 0.480 4 106171094 splice donor variant CAGATCTGTCTTTGGAGGATCTGGACACTCAGCAGAGAAATAAGGTGCCGAACTTCTGCCTCCACTGCTGTCAGAAGATGGCTTTGGAGGTTGAGCATGCTGTCTGTAAGTAGCACTTTTAGGAGTCCAACAAAACAGGTTGATAGATTCTCTCACACAGCGTTCAATGTCAATTTC/- delins 0.700 0
dbSNP: rs1564045331
rs1564045331
XPA
35 0.716 0.320 9 97687208 inframe deletion ATTCTT/- delins 0.700 0
dbSNP: rs199564797
rs199564797
25 0.742 0.360 1 25809150 missense variant G/A snv 1.2E-05 1.4E-05 0.700 0
dbSNP: rs745886248
rs745886248
25 0.742 0.360 1 25811710 missense variant G/A;C;T snv 4.3E-06; 4.3E-06; 4.3E-06 0.700 0
dbSNP: rs770703007
rs770703007
8 0.851 0.120 16 1706450 stop gained C/G;T snv 4.0E-06 0.700 0
dbSNP: rs778543124
rs778543124
XPA
35 0.716 0.320 9 97675476 frameshift variant AGTCTTACGGTACA/- delins 6.8E-05 6.3E-05 0.700 0