Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs587777893
rs587777893
67 0.658 0.240 1 11128107 missense variant G/A;T snv 0.700 1.000 1 2016 2016
dbSNP: rs1057518879
rs1057518879
19 0.776 0.280 1 11965571 stop gained G/A snv 0.700 0
dbSNP: rs1057519925
rs1057519925
25 0.683 0.560 3 179210291 missense variant G/A;C snv 0.700 0
dbSNP: rs1131691771
rs1131691771
18 0.807 0.160 6 78958469 splice donor variant ACTT/- delins 0.700 0
dbSNP: rs1557570794
rs1557570794
15 0.742 0.120 1 26697152 frameshift variant -/GCCGCCTCCCTCCTCCAGCGCC delins 0.700 0
dbSNP: rs1557781252
rs1557781252
33 0.742 0.320 1 153816414 stop gained G/A snv 0.700 0