Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs137852577
rs137852577
AR
3 0.878 0.179 X 67722898 missense variant C/T snp 0.700 9 1992 2017
dbSNP: rs137852569
rs137852569
AR
3 0.878 0.179 X 67686030 missense variant G/A snp 0.700 4 1992 2018
dbSNP: rs886039558
rs886039558
AR
2 0.923 0.179 X 67717561 stop gained C/T snp 0.700 4 1999 2017
dbSNP: rs193922933
rs193922933
1 1.000 0.071 X 67545318 coding sequence variant GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG/G. microsatellite 0.700 2 2001 2008
dbSNP: rs9332971
rs9332971
AR
4 0.846 0.179 X 67722944 missense variant G/A,T snp 0.700 1 2017 2017
dbSNP: rs730880031
rs730880031
6 0.821 0.107 22 23767438 missense variant C/A,T snp 1.8E-05; 4.4E-06 0.010 1.000 1 2016 2016
dbSNP: rs765672269
rs765672269
5 0.846 0.107 16 1792338 stop gained C/A snp 0.010 1.000 1 2016 2016
dbSNP: rs80265967
rs80265967
13 0.744 0.214 21 31667290 missense variant A/C snp 1.4E-03 2.1E-03 0.010 1.000 1 2010 2010