Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs79555199
rs79555199
1 1.000 0.160 10 100750707 missense variant G/A snv 0.800 1.000 1 2011 2011
dbSNP: rs104894170
rs104894170
3 0.925 0.160 10 100749914 missense variant G/C snv 0.700 1.000 6 1998 2014
dbSNP: rs1403345811
rs1403345811
1 1.000 0.160 10 100809132 missense variant C/T snv 0.700 1.000 6 1998 2014
dbSNP: rs387906530
rs387906530
1 1.000 0.160 10 100750699 protein altering variant -/AGACCG delins 0.700 1.000 2 1998 2012
dbSNP: rs1554856032
rs1554856032
2 0.925 0.160 10 100750720 missense variant C/T snv 0.700 1.000 1 2014 2014
dbSNP: rs75462234
rs75462234
4 0.851 0.160 10 100749772 frameshift variant G/-;GG;GGG delins 0.700 1.000 1 2017 2017
dbSNP: rs75399846
rs75399846
1 1.000 0.160 10 100806519 stop gained C/T snv 0.700 0
dbSNP: rs76675173
rs76675173
1 1.000 0.160 10 100749832 frameshift variant TGGCCCACCAGGGTGTGCGGCC/- delins 0.700 0
dbSNP: rs77777862
rs77777862
1 1.000 0.160 10 100781310 frameshift variant C/- del 0.700 0
dbSNP: rs78122364
rs78122364
1 1.000 0.160 10 100824682 stop gained C/A;T snv 5.2E-05 0.700 0
dbSNP: rs893370744
rs893370744
1 1.000 0.160 10 100809140 missense variant C/G;T snv 7.0E-06 0.700 0