Variant Gene N. diseases v DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs33939927
rs33939927
18 0.734 0.107 12 40310434 missense variant C/A,G,T snp 4.0E-06; 1.2E-05 0.720 0.500 3 2007 2017
dbSNP: rs76763715
rs76763715
GBA
11 0.744 0.179 1 155235843 missense variant T/C,G snp 2.3E-03 1.6E-03 0.700 18 1988 2015
dbSNP: rs421016
rs421016
GBA
11 0.784 0.179 1 155235252 missense variant A/C,G snp 8.0E-06; 1.3E-03 0.700 15 1987 2013
dbSNP: rs193922935
rs193922935
2 0.923 0.071 6 170561908 splice donor variant GCAGCAGCAG/G. microsatellite 0.700 8 1999 2005
dbSNP: rs193922930
rs193922930
2 0.923 0.071 13 70139384 non coding transcript exon variant ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG/A. microsatellite 0.700 6 1999 2009
dbSNP: rs63751392
rs63751392
1 1.000 17 46010374 inframe deletion AATA/A in-del 0.700 5 2000 2004
dbSNP: rs80356771
rs80356771
GBA
5 0.821 0.107 1 155235196 missense variant G/A,T snp 7.2E-05; 4.0E-06 3.2E-05 0.700 4 1990 2009
dbSNP: rs72480422
rs72480422
2 0.923 0.036 6 161785805 missense variant C/A,T snp 4.0E-06; 1.6E-04 9.6E-05 0.700 3 2000 2010
dbSNP: rs387907571
rs387907571
6 0.821 0.071 3 132477995 missense variant A/G snp 4.2E-06 0.700 2 2014 2015
dbSNP: rs1056737920
rs1056737920
1 1.000 20 5109345 missense variant T/C snp 0.700 1 2016 2016
dbSNP: rs145242123
rs145242123
1 1.000 3 132522838 missense variant C/A,T snp 4.1E-06; 1.5E-03 2.1E-03 0.700 1 2015 2015
dbSNP: rs146930051
rs146930051
1 1.000 3 132467269 missense variant G/T snp 2.0E-05 3.2E-05 0.700 1 2015 2015
dbSNP: rs193922928
rs193922928
2 0.923 0.071 14 92071011 splice region variant CCTGCTGCTGCTGCTGCTGCTGCTG/C. microsatellite 0.700 1 1995 1995
dbSNP: rs199476120
rs199476120
ND1
3 0.878 0.071 MT 3397 missense variant snp 0.700 1 1995 1995
dbSNP: rs747427602
rs747427602
1 1.000 6 161785885 missense variant C/T snp 1.6E-05 0.700 1 2003 2003
dbSNP: rs75671029
rs75671029
GBA
1 1.000 1 155235256 missense variant C/T snp 5.2E-04 2.2E-03 0.700 1 2009 2009
dbSNP: rs764786986
rs764786986
1 1.000 20 5100921 missense variant C/A,T snp 4.0E-06; 2.4E-05 3.2E-05 0.700 1 2016 2016
dbSNP: rs766013346
rs766013346
1 1.000 3 132492587 missense variant G/A,T snp 1.6E-05 3.2E-05; 3.2E-05 0.700 1 2015 2015
dbSNP: rs9697983
rs9697983
2 0.923 0.036 X 121049176 missense variant T/G snp 2.7E-02 3.5E-02 0.700 1 2010 2010
dbSNP: rs150562946
rs150562946
3 0.878 0.036 6 161785877 missense variant G/A snp 4.2E-04 5.1E-04 0.700 0
dbSNP: rs34424986
rs34424986
8 0.784 0.107 6 161785820 missense variant G/A,T snp 1.9E-03; 8.0E-06 2.3E-03 0.700 0
dbSNP: rs34637584
rs34637584
47 0.630 0.321 12 40340400 missense variant G/A snp 5.3E-04 1.9E-04 0.090 1.000 9 2006 2015
dbSNP: rs188286943
rs188286943
8 0.784 0.143 16 46662452 missense variant C/T snp 0.040 1.000 4 2011 2015
dbSNP: rs112176450
rs112176450
5 0.846 0.071 3 184327401 missense variant G/A snp 2.1E-04 1.6E-04 0.010 1.000 1 2013 2013
dbSNP: rs12678719
rs12678719
1 1.000 8 105503826 intron variant C/G snp 0.36 0.010 1.000 1 2012 2012