Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
---|---|---|---|---|---|---|---|---|---|---|
|
C | 0.700 | CausalMutation | CLINVAR | Postmortem genetic screening for the identification, verification, and reporting of genetic variants contributing to the sudden death of the young. | 27435932 | 2016 |
|||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | GeneticVariation | CLINVAR | ||||||
|
CGGGGCGATGGGAGCTGGCCG | 0.700 | CausalMutation | CLINVAR | ||||||
|
GCTTTT | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
TGCAG | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
CGCCT | 0.700 | CausalMutation | CLINVAR | ||||||
|
AG | 0.700 | CausalMutation | CLINVAR | ||||||
|
GCCGC | 0.700 | CausalMutation | CLINVAR | ||||||
|
ACGTCGCCC | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
CCTGCGCGAT | 0.700 | CausalMutation | CLINVAR | ||||||
|
ACCAC | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
0.040 | GeneticVariation | BEFREE | Herein, we summarize the current evidence on the pivotal role of HRC in the regulation of cardiac rhythmicity and the importance of HRC Ser96Ala as a genetic modifier for arrhythmias in the setting of heart failure. | 30319456 | 2018 |