Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
---|---|---|---|---|---|---|---|---|---|---|
|
T | 0.700 | GeneticVariation | CLINVAR | Cancer predisposing missense and protein truncating BARD1 mutations in non-BRCA1 or BRCA2 breast cancer families. | 20077502 | 2010 |
|||
|
G | 0.700 | GeneticVariation | CLINVAR | Structural requirements for the BARD1 tumor suppressor in chromosomal stability and homology-directed DNA repair. | 17848578 | 2007 |
|||
|
CT | 0.700 | GeneticVariation | CLINVAR | Structural requirements for the BARD1 tumor suppressor in chromosomal stability and homology-directed DNA repair. | 17848578 | 2007 |
|||
|
T | 0.700 | GeneticVariation | CLINVAR | Crystal structure of the BARD1 BRCT domains. | 17550235 | 2007 |
|||
|
T | 0.700 | GeneticVariation | CLINVAR | Structural requirements for the BARD1 tumor suppressor in chromosomal stability and homology-directed DNA repair. | 17848578 | 2007 |
|||
|
A | 0.700 | GeneticVariation | CLINVAR | Crystal structure of the BARD1 BRCT domains. | 17550235 | 2007 |
|||
|
A | 0.700 | GeneticVariation | CLINVAR | Structural requirements for the BARD1 tumor suppressor in chromosomal stability and homology-directed DNA repair. | 17848578 | 2007 |
|||
|
C | 0.700 | CausalMutation | CLINVAR | BRCA1-dependent and independent functions of BARD1. | 11943588 | 2002 |
|||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | GeneticVariation | CLINVAR | ||||||
|
CGC | 0.700 | CausalMutation | CLINVAR | ||||||
|
0.700 | GeneticVariation | UNIPROT | |||||||
|
A | 0.700 | GeneticVariation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
CA | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
CTAGCTGAGGATGATTCATTCTTCTCTGGT | 0.700 | CausalMutation | CLINVAR | ||||||
|
AT | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
ATG | 0.700 | CausalMutation | CLINVAR |