Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
---|---|---|---|---|---|---|---|---|---|---|
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | GeneticVariation | CLINVAR | Identification of a mutation in liver glycogen phosphorylase in glycogen storage disease type VI. | 9536091 | 1998 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | Mutations in the liver glycogen phosphorylase gene (PYGL) underlying glycogenosis type VI. | 9529348 | 1998 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | Identification of a mutation in liver glycogen phosphorylase in glycogen storage disease type VI. | 9536091 | 1998 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | Liver glycogen storage diseases due to phosphorylase system deficiencies: diagnosis thanks to non invasive blood enzymatic and molecular studies. | 21646031 | 2012 |
|||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | The natural history of glycogen storage disease types VI and IX: Long-term outcome from the largest metabolic center in Canada. | 25266922 | 2014 |
|||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | Clinical application of massively parallel sequencing in the molecular diagnosis of glycogen storage diseases of genetically heterogeneous origin. | 22899091 | 2013 |
|||
|
GCTGATCTGCCGCCGCTTCTC | 0.700 | CausalMutation | CLINVAR |