| Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
|---|---|---|---|---|---|---|---|---|---|---|
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
TG | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
AT | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
AT | 0.700 | CausalMutation | CLINVAR | Risks of Lynch syndrome cancers for MSH6 mutation carriers. | 20028993 | 2010 |
|||
|
AT | 0.700 | CausalMutation | CLINVAR | Lynch syndrome mutation spectrum in New South Wales, Australia, including 55 novel mutations. | 27064304 | 2016 |
|||
|
AT | 0.700 | CausalMutation | CLINVAR | Tumor mismatch repair immunohistochemistry and DNA MLH1 methylation testing of patients with endometrial cancer diagnosed at age younger than 60 years optimizes triage for population-level germline mismatch repair gene mutation testing. | 24323032 | 2014 |
|||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | GeneticVariation | CLINVAR | Population-based molecular screening for Lynch syndrome: implications for personalized medicine. | 23733757 | 2013 |
|||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | GeneticVariation | CLINVAR | ||||||
|
TGGCTTTAATGCAGCAAGGCTTGCTAATCTCCCAGA | 0.700 | CausalMutation | CLINVAR | ||||||
|
AG | 0.700 | GeneticVariation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | Somatic POLE mutations cause an ultramutated giant cell high-grade glioma subtype with better prognosis. | 25740784 | 2015 |
|||
|
C | 0.700 | CausalMutation | CLINVAR |