Variant Gene Risk Allele Score vda Association Type Original DB Sentence supporting the association PMID PMID Year
dbSNP: rs61755320
rs61755320
T 0.720 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs116171274
rs116171274
A 0.710 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs121908613
rs121908613
T 0.710 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs104894490
rs104894490
A 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs1085307110
rs1085307110
EPHB1 ; CEP63 ; KY
CATGTCGATAGATACAGCACATGTCGATA 0.700 CausalMutation CLINVAR Progressive hereditary spastic paraplegia caused by a homozygous KY mutation. 28488683

2017

dbSNP: rs1553316816
rs1553316816
A 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs1554524697
rs1554524697
CA 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs1555177629
rs1555177629
T 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs1555394376
rs1555394376
CA 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs200133991
rs200133991
T 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs312262720
rs312262720
C 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs387907288
rs387907288
A 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs398123012
rs398123012
A 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs398123015
rs398123015
T 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs548204329
rs548204329
A 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs562890289
rs562890289
T 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs750663981
rs750663981
AG 0.700 CausalMutation CLINVAR

dbSNP: rs760818649
rs760818649
GC 0.700 CausalMutation CLINVAR Spastic paraplegia gene 7 in patients with spasticity and/or optic neuropathy. 23065789

2012

dbSNP: rs760818649
rs760818649
GC 0.700 CausalMutation CLINVAR Hereditary spastic paraplegia caused by the novel mutation 1047insC in the SPG7 gene. 18563470

2008

dbSNP: rs760818649
rs760818649
GC 0.700 CausalMutation CLINVAR SPG7 mutations are a common cause of undiagnosed ataxia. 25681447

2015

dbSNP: rs760818649
rs760818649
GC 0.700 CausalMutation CLINVAR A founder mutation p.H701P identified as a major cause of SPG7 in Norway. 26756429

2016

dbSNP: rs760818649
rs760818649
GC 0.700 CausalMutation CLINVAR Clinical and genetic study of hereditary spastic paraplegia in Canada. 27957547

2017

dbSNP: rs760818649
rs760818649
GC 0.700 CausalMutation CLINVAR Autosomal recessive hereditary spastic paraplegia-clinical and genetic characteristics of a well-defined cohort. 23733235

2013

dbSNP: rs768136171
rs768136171
C 0.700 CausalMutation CLINVAR Spastic paraplegia and OXPHOS impairment caused by mutations in paraplegin, a nuclear-encoded mitochondrial metalloprotease. 9635427

1998

dbSNP: rs768823392
rs768823392
A 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017