Variant Gene Risk Allele Score vda Association Type Original DB Sentence supporting the association PMID PMID Year
dbSNP: rs104894490
A 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565


dbSNP: rs1085307110
EPHB1 ; CEP63 ; KY
CATGTCGATAGATACAGCACATGTCGATA 0.700 CausalMutation CLINVAR Progressive hereditary spastic paraplegia caused by a homozygous KY mutation. 28488683


dbSNP: rs116171274
A 0.710 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565


dbSNP: rs116171274
0.710 GeneticVariation BEFREE Generation of induced pluripotent stem cells (iPSCs) from a hereditary spastic paraplegia patient carrying a homozygous R486C mutation in CYP7B1 (SPG5). 27879216


dbSNP: rs121908613
T 0.710 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565


dbSNP: rs121908613
0.710 GeneticVariation BEFREE Generation of induced pluripotent stem cells (iPSCs) from a hereditary spastic paraplegia patient carrying a homozygous Y275X mutation in CYP7B1 (SPG5). 27879220


dbSNP: rs1265011107
0.010 GeneticVariation BEFREE An hsp60 D3G mutation leads to MitCHAP-60, an early onset neurodegenerative disease while hsp60 V72I has been linked to SPG13, a form of hereditary spastic paraplegia. 31444388


dbSNP: rs1266102026
G 0.700 GeneticVariation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565


dbSNP: rs1313275799
0.010 GeneticVariation BEFREE A novel homozygous p.R1105X mutation of the AP4E1 gene in twins with hereditary spastic paraplegia and mycobacterial disease. 23472171


dbSNP: rs1331686243
0.010 GeneticVariation BEFREE Novel SPG6 mutation p.A100T in a Japanese family with autosomal dominant form of hereditary spastic paraplegia. 16795073


dbSNP: rs1377512692
0.010 GeneticVariation BEFREE The TmFtsH A359V mutation, a homolog of the human pathogenic A510V mutation of paraplegin (SPG7) causing hereditary spastic paraplegia, does not affect the dynamic behavior of the protease but impairs the ATP-coupled domain compaction and, thus, may account for protease malfunctioning and pathogenesis in hereditary spastic paraplegia. 30044948


dbSNP: rs1553316816
A 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565


dbSNP: rs1554524697
CA 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565


dbSNP: rs1555177629
T 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565


dbSNP: rs1555177824
T 0.700 GeneticVariation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565


dbSNP: rs1555177831
C 0.700 GeneticVariation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565


dbSNP: rs1555394376
CA 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565


dbSNP: rs200133991
T 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565


dbSNP: rs312262720
C 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565


dbSNP: rs367916692
0.010 GeneticVariation BEFREE The patient was homozygous for a mutation (c.1249C>T) in CYP7B1 that alters a highly conserved residue in oxysterol 7 α-hydroxylase (p.R417C) - previously reported in a family with hereditary spastic paraplegia type 5. 24658845


dbSNP: rs372702043
0.010 GeneticVariation BEFREE The TmFtsH A359V mutation, a homolog of the human pathogenic A510V mutation of paraplegin (SPG7) causing hereditary spastic paraplegia, does not affect the dynamic behavior of the protease but impairs the ATP-coupled domain compaction and, thus, may account for protease malfunctioning and pathogenesis in hereditary spastic paraplegia. 30044948


dbSNP: rs387907288
A 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565


dbSNP: rs398123012
A 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565


dbSNP: rs398123015
T 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565


dbSNP: rs537742207
0.010 GeneticVariation BEFREE An hsp60 D3G mutation leads to MitCHAP-60, an early onset neurodegenerative disease while hsp60 V72I has been linked to SPG13, a form of hereditary spastic paraplegia. 31444388