Variant Gene Risk Allele Score vda Association Type Original DB Sentence supporting the association PMID PMID Year
dbSNP: rs1331686243
rs1331686243
0.010 GeneticVariation BEFREE Novel SPG6 mutation p.A100T in a Japanese family with autosomal dominant form of hereditary spastic paraplegia. 16795073

2006

dbSNP: rs1377512692
rs1377512692
APP
0.010 GeneticVariation BEFREE The TmFtsH A359V mutation, a homolog of the human pathogenic A510V mutation of paraplegin (SPG7) causing hereditary spastic paraplegia, does not affect the dynamic behavior of the protease but impairs the ATP-coupled domain compaction and, thus, may account for protease malfunctioning and pathogenesis in hereditary spastic paraplegia. 30044948

2018

dbSNP: rs367916692
rs367916692
0.010 GeneticVariation BEFREE The patient was homozygous for a mutation (c.1249C>T) in CYP7B1 that alters a highly conserved residue in oxysterol 7 α-hydroxylase (p.R417C) - previously reported in a family with hereditary spastic paraplegia type 5. 24658845

2014

dbSNP: rs372702043
rs372702043
APP
0.010 GeneticVariation BEFREE The TmFtsH A359V mutation, a homolog of the human pathogenic A510V mutation of paraplegin (SPG7) causing hereditary spastic paraplegia, does not affect the dynamic behavior of the protease but impairs the ATP-coupled domain compaction and, thus, may account for protease malfunctioning and pathogenesis in hereditary spastic paraplegia. 30044948

2018

dbSNP: rs537742207
rs537742207
0.010 GeneticVariation BEFREE An hsp60 D3G mutation leads to MitCHAP-60, an early onset neurodegenerative disease while hsp60 V72I has been linked to SPG13, a form of hereditary spastic paraplegia. 31444388

2019

dbSNP: rs587777132
rs587777132
0.010 GeneticVariation BEFREE Infantile-onset ascending hereditary spastic paraplegia with bulbar involvement due to the novel ALS2 mutation c.2761C>T. 24315819

2014

dbSNP: rs587777757
rs587777757
0.010 GeneticVariation BEFREE The authors report a nucleotide substitution (c.1216A>G) in SPG4 (spastin) causing hereditary spastic paraplegia. 16476945

2006

dbSNP: rs770388772
rs770388772
0.010 GeneticVariation BEFREE The authors report a nucleotide substitution (c.1216A>G) in SPG4 (spastin) causing hereditary spastic paraplegia. 16476945

2006

dbSNP: rs864622269
rs864622269
0.010 GeneticVariation BEFREE Six patients with an SPG3A mutation (F151S, Q191R, M408T, G469A, R495W) originating from 5 unrelated families presented with a complex form of hereditary spastic paraplegia associated with a neuropathy (17%). 17502470

2007

dbSNP: rs878854991
rs878854991
0.010 GeneticVariation BEFREE An extensive genetic analysis identified a specific class of heterozygous germline mutation in SPAST, p.(Arg499His), which is responsible for hereditary spastic paraplegia with infantile onset. 31698101

2019

dbSNP: rs890815306
rs890815306
APP
0.010 GeneticVariation BEFREE The TmFtsH A359V mutation, a homolog of the human pathogenic A510V mutation of paraplegin (SPG7) causing hereditary spastic paraplegia, does not affect the dynamic behavior of the protease but impairs the ATP-coupled domain compaction and, thus, may account for protease malfunctioning and pathogenesis in hereditary spastic paraplegia. 30044948

2018

dbSNP: rs897755799
rs897755799
0.010 GeneticVariation BEFREE The patient was homozygous for a mutation (c.1249C>T) in CYP7B1 that alters a highly conserved residue in oxysterol 7 α-hydroxylase (p.R417C) - previously reported in a family with hereditary spastic paraplegia type 5. 24658845

2014

dbSNP: rs61755320
rs61755320
T 0.720 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs116171274
rs116171274
A 0.710 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs121908613
rs121908613
T 0.710 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs104894490
rs104894490
A 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs1085307110
rs1085307110
EPHB1 ; CEP63 ; KY
CATGTCGATAGATACAGCACATGTCGATA 0.700 CausalMutation CLINVAR Progressive hereditary spastic paraplegia caused by a homozygous KY mutation. 28488683

2017

dbSNP: rs1553316816
rs1553316816
A 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs1554524697
rs1554524697
CA 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs1555177629
rs1555177629
T 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs1555394376
rs1555394376
CA 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs200133991
rs200133991
T 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs312262720
rs312262720
C 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs387907288
rs387907288
A 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017

dbSNP: rs398123012
rs398123012
A 0.700 CausalMutation CLINVAR Massive sequencing of 70 genes reveals a myriad of missing genes or mechanisms to be uncovered in hereditary spastic paraplegias. 28832565

2017