| Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
|---|---|---|---|---|---|---|---|---|---|---|
|
0.010 | GeneticVariation | BEFREE | Here, we report a Taiwanese family with HNPCC and mutation analysis revealed a novel nonsense mutation (S611X) in MSH2 gene. | 21354521 | 2011 |
||||
|
A | 0.700 | GeneticVariation | CLINVAR | ||||||
|
G | 0.700 | GeneticVariation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | Germline, somatic and epigenetic events underlying mismatch repair deficiency in colorectal and HNPCC-related cancers. | 12386821 | 2002 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | MSH2 c.1452-1455delAATG is a founder mutation and an important cause of hereditary nonpolyposis colorectal cancer in the southern Chinese population. | 15042510 | 2004 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | Frequent microsatellite instability and mismatch repair gene mutations in young Chinese patients with colorectal cancer. | 10413423 | 1999 |
|||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
CA | 0.700 | GeneticVariation | CLINVAR | Gene-related cancer spectrum in families with hereditary non-polyposis colorectal cancer (HNPCC). | 17939062 | 2008 |
|||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | GeneticVariation | CLINVAR | Exome sequencing covers >98% of mutations identified on targeted next generation sequencing panels. | 28152038 | 2017 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | GeneticVariation | CLINVAR | ||||||
|
C | 0.700 | GeneticVariation | CLINVAR | ||||||
|
C | 0.700 | GeneticVariation | CLINVAR | ||||||
|
0.010 | GeneticVariation | BEFREE | Here, we describe a putative LS family carrying VUS in both MSH2 (c.2768T>A, p.Val923Glu) and MSH6 (c.3563G>A, p.Ser1188Asn). | 21431882 | 2011 |
||||
|
AG | 0.700 | CausalMutation | CLINVAR | ||||||
|
G | 0.700 | GeneticVariation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
AAAAGATCTTCTTCTGGTTCGTC | 0.700 | CausalMutation | CLINVAR | ||||||
|
AGAGGAAACTAGGACTGTGTGAATTCCCTGATAATGATCAGTTCTCCAATCTTGAGGCTCTCCTCATCCAGATT | 0.700 | CausalMutation | CLINVAR | ||||||
|
GGAGA | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR |