Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
---|---|---|---|---|---|---|---|---|---|---|
|
G | 0.700 | GeneticVariation | CLINVAR | ||||||
|
0.700 | GeneticVariation | UNIPROT | Screening of SLC25A13 mutations in early and late onset patients with citrin deficiency and in the Japanese population: Identification of two novel mutations and establishment of multiple DNA diagnosis methods for nine mutations. | 11793471 | 2002 |
||||
|
0.010 | GeneticVariation | BEFREE | The patients with NICCD had a higher frequency of the rs6957975 polymorphism compared with 103 healthy controls (P < .0001). | 22575253 | 2012 |
||||
|
GCCCCGGGCAGCCACCTGTAATCT | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | Seven genetic variations of SLC25A13, termed as 851del4, 1638ins23, IVS16ins3kb, IVS6+5G>A, c.775C>T (p.Q259X), c.1505C>T (p.P502L) and c.1311C>T (p.C437C), were identified in the subjects, of which c.775C>T (p.Q259X), c.1505C>T (p.P502L) and c.1311C>T (p.C437C) were reported for the first time in NICCD patients. | 21507300 | 2011 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
GCCCGGGCAGCCACCTGTAATCTC | 0.700 | CausalMutation | CLINVAR | ||||||
|
GT | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | [Clinical investigation and mutation analysis of a child with citrin deficiency complicated with purpura, convulsive seizures and methioninemia]. | 24327139 | 2013 |