Variant | Gene | Risk Allele | Score vda | Association Type | Original DB | Sentence supporting the association | PMID | PMID Year | ||
---|---|---|---|---|---|---|---|---|---|---|
|
C | 0.700 | GeneticVariation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
TCTCCTCCTCGCCTCCTC | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | ||||||
|
CG | 0.700 | CausalMutation | CLINVAR | ||||||
|
0.700 | GeneticVariation | UNIPROT | |||||||
|
C | 0.700 | CausalMutation | CLINVAR | ||||||
|
T | 0.700 | CausalMutation | CLINVAR | ||||||
|
A | 0.700 | CausalMutation | CLINVAR | [Technic of the entire cochleogram for the study of the cochlea in guinea pigs]. | 1241840 | 1975 |
|||
|
A | 0.700 | CausalMutation | CLINVAR | Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. | 10508514 | 1999 |
|||
|
A | 0.700 | CausalMutation | CLINVAR | Rett syndrome is caused by mutations in X-linked MECP2, encoding methyl-CpG-binding protein 2. | 10508514 | 1999 |
|||
|
A | 0.700 | CausalMutation | CLINVAR | Rett syndrome and beyond: recurrent spontaneous and familial MECP2 mutations at CpG hotspots. | 10577905 | 1999 |
|||
|
A | 0.700 | CausalMutation | CLINVAR | Rett syndrome and beyond: recurrent spontaneous and familial MECP2 mutations at CpG hotspots. | 10577905 | 1999 |
|||
|
G | 0.700 | CausalMutation | CLINVAR | Rett syndrome and beyond: recurrent spontaneous and familial MECP2 mutations at CpG hotspots. | 10577905 | 1999 |
|||
|
CATCCCAGGACGCAGGTGGATCCGAGTCTGCTGCATAGACGGCCATTAGGTCCCAGGATGGAGCTGGATTCGAGCCTGCTGTGCTCCAAATGGTTACGGTGGTGAATTCTGTT | 0.700 | CausalMutation | CLINVAR | Long-read sequence analysis of the MECP2 gene in Rett syndrome patients: correlation of disease severity with mutation type and location. | 10767337 | 2000 |
|||
|
T | 0.700 | CausalMutation | CLINVAR | Long-read sequence analysis of the MECP2 gene in Rett syndrome patients: correlation of disease severity with mutation type and location. | 10767337 | 2000 |
|||
|
C | 0.700 | CausalMutation | CLINVAR | Long-read sequence analysis of the MECP2 gene in Rett syndrome patients: correlation of disease severity with mutation type and location. | 10767337 | 2000 |
|||
|
C | 0.700 | CausalMutation | CLINVAR | Long-read sequence analysis of the MECP2 gene in Rett syndrome patients: correlation of disease severity with mutation type and location. | 10767337 | 2000 |