Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs199473693
rs199473693
0.882 0.160 1 150553750 frameshift variant AGGCCTCTGGCACAGAGCCC/- delins
Ectopia Lentis with Ectopia of Pupil
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs747160538
rs747160538
1.000 0.160 1 150558030 frameshift variant G/-;GG delins 4.9E-05
Ectopia Lentis with Ectopia of Pupil
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases 0.700 0
dbSNP: rs794726688
rs794726688
0.925 0.160 1 150553816 frameshift variant CGTGCATCCCC/- delins
Ectopia Lentis with Ectopia of Pupil
Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases 0.700 0