Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
0.763 | 0.200 | 3 | 46370444 | intron variant | A/G | snv | 0.49 |
|
Digestive System Diseases; Infections | 0.010 | 1.000 | 1 | 2018 | 2018 | |||||||
|
0.763 | 0.200 | 3 | 46370444 | intron variant | A/G | snv | 0.49 |
|
Digestive System Diseases | 0.010 | 1.000 | 1 | 2011 | 2011 | |||||||
|
0.763 | 0.200 | 3 | 46370444 | intron variant | A/G | snv | 0.49 |
|
Neoplasms | 0.010 | 1.000 | 1 | 2019 | 2019 | |||||||
|
0.763 | 0.200 | 3 | 46370444 | intron variant | A/G | snv | 0.49 |
|
Nervous System Diseases; Cardiovascular Diseases | 0.010 | 1.000 | 1 | 2012 | 2012 | |||||||
|
1.000 | 0.040 | 3 | 46370768 | intron variant | C/T | snv | 0.49 |
|
Neoplasms | 0.010 | 1.000 | 1 | 2019 | 2019 | |||||||
|
1.000 | 0.040 | 3 | 46370817 | intron variant | A/G | snv | 0.29 |
|
Neoplasms | 0.010 | 1.000 | 1 | 2019 | 2019 | |||||||
|
1.000 | 0.040 | 3 | 46370817 | intron variant | A/G | snv | 0.29 |
|
Neoplasms; Hemic and Lymphatic Diseases | 0.010 | 1.000 | 1 | 2017 | 2017 | |||||||
|
0.925 | 0.080 | 3 | 46371068 | intron variant | C/T | snv | 0.13 |
|
Neoplasms | 0.010 | 1.000 | 1 | 2019 | 2019 | |||||||
|
0.925 | 0.080 | 3 | 46371068 | intron variant | C/T | snv | 0.13 |
|
Skin and Connective Tissue Diseases | 0.010 | 1.000 | 1 | 2017 | 2017 | |||||||
|
3 | 46373570 | missense variant | G/A | snv | 4.9E-03 | 1.9E-03 |
|
Infections; Immune System Diseases | 0.010 | 1.000 | 1 | 2005 | 2005 | ||||||||
|
1.000 | 3 | 46373218 | missense variant | G/A | snv | 5.2E-04 | 1.5E-04 |
|
0.010 | 1.000 | 1 | 2004 | 2004 | ||||||||
|
1.000 | 3 | 46373218 | missense variant | G/A | snv | 5.2E-04 | 1.5E-04 |
|
Infections; Immune System Diseases | 0.010 | 1.000 | 1 | 2005 | 2005 | |||||||
|
1.000 | 3 | 46373708 | missense variant | G/A;T | snv | 3.2E-05; 1.2E-05 |
|
0.010 | 1.000 | 1 | 2004 | 2004 | |||||||||
|
1.000 | 0.040 | 3 | 46370051 | intron variant | G/A | snv | 0.63 |
|
Neoplasms | 0.010 | 1.000 | 1 | 2019 | 2019 | |||||||
|
1.000 | 0.040 | 3 | 46370349 | intron variant | G/T | snv | 0.36 |
|
Neoplasms | 0.010 | 1.000 | 1 | 2019 | 2019 | |||||||
|
1.000 | 0.080 | 3 | 46408579 | missense variant | T/A | snv | 0.38 | 0.31 |
|
Infections; Respiratory Tract Diseases | 0.010 | 1.000 | 1 | 2011 | 2011 | ||||||
|
0.667 | 0.520 | 3 | 46373453 | frameshift variant | GTCAGTATCAATTCTGGAAGAATTTCCAGACA/- | delins | 7.3E-02 |
|
Stomatognathic Diseases | 0.010 | 1.000 | 1 | 2018 | 2018 | |||||||
|
0.667 | 0.520 | 3 | 46373453 | frameshift variant | GTCAGTATCAATTCTGGAAGAATTTCCAGACA/- | delins | 7.3E-02 |
|
Neoplasms; Male Urogenital Diseases | 0.010 | 1.000 | 1 | 2013 | 2013 | |||||||
|
0.667 | 0.520 | 3 | 46373453 | frameshift variant | GTCAGTATCAATTCTGGAAGAATTTCCAGACA/- | delins | 7.3E-02 |
|
Neoplasms; Female Urogenital Diseases and Pregnancy Complications | 0.010 | 1.000 | 1 | 2016 | 2016 | |||||||
|
0.667 | 0.520 | 3 | 46373453 | frameshift variant | GTCAGTATCAATTCTGGAAGAATTTCCAGACA/- | delins | 7.3E-02 |
|
Infections; Nervous System Diseases | 0.010 | 1.000 | 1 | 2019 | 2019 | |||||||
|
0.667 | 0.520 | 3 | 46373453 | frameshift variant | GTCAGTATCAATTCTGGAAGAATTTCCAGACA/- | delins | 7.3E-02 |
|
Infections | 0.010 | 1.000 | 1 | 2015 | 2015 | |||||||
|
0.667 | 0.520 | 3 | 46373453 | frameshift variant | GTCAGTATCAATTCTGGAAGAATTTCCAGACA/- | delins | 7.3E-02 |
|
Stomatognathic Diseases | 0.010 | 1.000 | 1 | 2018 | 2018 | |||||||
|
0.667 | 0.520 | 3 | 46373453 | frameshift variant | GTCAGTATCAATTCTGGAAGAATTTCCAGACA/- | delins | 7.3E-02 |
|
Infections | 0.010 | 1.000 | 1 | 2017 | 2017 | |||||||
|
0.667 | 0.520 | 3 | 46373453 | frameshift variant | GTCAGTATCAATTCTGGAAGAATTTCCAGACA/- | delins | 7.3E-02 |
|
Digestive System Diseases; Infections | 0.010 | 1.000 | 1 | 2018 | 2018 | |||||||
|
0.667 | 0.520 | 3 | 46373453 | frameshift variant | GTCAGTATCAATTCTGGAAGAATTTCCAGACA/- | delins | 7.3E-02 |
|
0.010 | 1.000 | 1 | 2019 | 2019 |