Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
1 | 247438293 | intron variant | T/C | snv | 0.58 |
|
0.800 | 1.000 | 3 | 2011 | 2019 | ||||||||||
|
1 | 247442297 | intron variant | C/G;T | snv |
|
0.800 | 1.000 | 2 | 2013 | 2016 | |||||||||||
|
1 | 247438293 | intron variant | T/C | snv | 0.58 |
|
0.800 | 1.000 | 2 | 2011 | 2017 | ||||||||||
|
1 | 247438293 | intron variant | T/C | snv | 0.58 |
|
0.700 | 1.000 | 2 | 2016 | 2019 | ||||||||||
|
1 | 247442297 | intron variant | C/G;T | snv |
|
0.700 | 1.000 | 1 | 2013 | 2013 | |||||||||||
|
1 | 247442297 | intron variant | C/G;T | snv |
|
0.700 | 1.000 | 1 | 2013 | 2013 | |||||||||||
|
1 | 247448993 | 3 prime UTR variant | C/T | snv | 0.55 |
|
Nutritional and Metabolic Diseases; Female Urogenital Diseases and Pregnancy Complications; Endocrine System Diseases | 0.010 | < 0.001 | 1 | 2018 | 2018 | |||||||||
|
1 | 247449260 | 3 prime UTR variant | T/C | snv | 0.58 |
|
0.700 | 1.000 | 1 | 2018 | 2018 | ||||||||||
|
1 | 247425398 | missense variant | A/G | snv | 4.0E-06 |
|
Pathological Conditions, Signs and Symptoms | 0.010 | 1.000 | 1 | 2015 | 2015 | |||||||||
|
1 | 247438293 | intron variant | T/C | snv | 0.58 |
|
0.700 | 1.000 | 1 | 2016 | 2016 | ||||||||||
|
1 | 247438293 | intron variant | T/C | snv | 0.58 |
|
0.700 | 1.000 | 1 | 2011 | 2011 | ||||||||||
|
1 | 247438293 | intron variant | T/C | snv | 0.58 |
|
0.700 | 1.000 | 1 | 2011 | 2011 | ||||||||||
|
1 | 247438293 | intron variant | T/C | snv | 0.58 |
|
0.700 | 1.000 | 1 | 2016 | 2016 | ||||||||||
|
1 | 247438293 | intron variant | T/C | snv | 0.58 |
|
0.700 | 1.000 | 1 | 2016 | 2016 | ||||||||||
|
1 | 247438293 | intron variant | T/C | snv | 0.58 |
|
0.700 | 1.000 | 1 | 2016 | 2016 | ||||||||||
|
1 | 247440079 | intron variant | CGTGTTAGGTATAGCCTA/-;CGTGTTAGGTATAGCCTACGTGTTAGGTATAGCCTA | delins | 0.61 |
|
0.700 | 1.000 | 1 | 2016 | 2016 | ||||||||||
|
1.000 | 1 | 247444061 | missense variant | G/A | snv |
|
0.700 | 1.000 | 1 | 2017 | 2017 | ||||||||||
|
1 | 247440161 | intron variant | G/A | snv | 0.33 |
|
0.700 | 1.000 | 1 | 2011 | 2011 | ||||||||||
|
1 | 247440161 | intron variant | G/A | snv | 0.33 |
|
0.700 | 1.000 | 1 | 2011 | 2011 | ||||||||||
|
1 | 247440161 | intron variant | G/A | snv | 0.33 |
|
0.700 | 1.000 | 1 | 2011 | 2011 | ||||||||||
|
1 | 247439006 | intron variant | T/A;G | snv |
|
0.700 | 1.000 | 1 | 2018 | 2018 | |||||||||||
|
0.925 | 0.040 | 1 | 247432548 | intron variant | C/T | snv | 0.11 |
|
Digestive System Diseases | 0.020 | 1.000 | 2 | 2010 | 2014 | |||||||
|
0.882 | 0.040 | 1 | 247443750 | intron variant | G/A | snv | 0.57 |
|
Cardiovascular Diseases | 0.010 | 1.000 | 1 | 2020 | 2020 | |||||||
|
0.882 | 0.040 | 1 | 247443750 | intron variant | G/A | snv | 0.57 |
|
Cardiovascular Diseases | 0.010 | 1.000 | 1 | 2020 | 2020 | |||||||
|
0.882 | 0.040 | 1 | 247443750 | intron variant | G/A | snv | 0.57 |
|
Cardiovascular Diseases | 0.010 | 1.000 | 1 | 2020 | 2020 |