CREBBP, CREB binding protein, 1387

N. diseases: 438; N. variants: 123
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs28937315
rs28937315
1.000 0.120 16 3757894 missense variant T/C snv
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.800 1.000 7 2001 2015
dbSNP: rs1057520191
rs1057520191
1.000 0.120 16 3736690 missense variant A/G snv
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 1.000 7 2001 2015
dbSNP: rs1555473499
rs1555473499
0.925 0.120 16 3738605 missense variant A/G snv
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 1.000 7 2001 2015
dbSNP: rs746728741
rs746728741
1.000 0.120 16 3773849 missense variant C/T snv 1.2E-05 1.4E-05
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 1.000 7 2001 2015
dbSNP: rs121434624
rs121434624
1.000 0.120 16 3850689 stop gained G/A;C snv 4.0E-06
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs121434625
rs121434625
0.925 0.120 16 3793533 stop gained G/A snv
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs121434626
rs121434626
1.000 0.120 16 3740399 missense variant C/G snv
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1302427305
rs1302427305
0.925 0.120 16 3792074 stop gained G/A snv
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs143247685
rs143247685
1.000 0.120 16 3770722 missense variant T/A;C snv 2.2E-04; 2.4E-03
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1555470631
rs1555470631
1.000 0.120 16 3727471 stop lost AAACGGAAAAAAAAGAACCCCCCCCACCCCCCCGCCAAAAAAAAACCAAAGAGAGAGACCAGATATTTAAATCAACTGGTTTTTAACAAAAAAATATATTCTTTGTATTGTTTCTTTAAACATCAATCCACCCTTCCATGGCTCGGAAGTCGCAGTTCCATCTAGGAATAAAAAGAACCTAGATGCCTGGATTTTCAGTACAAAAGGTCCAAGAACATGAAAGGGAAAAGGTGATGCTCTCACAATGCTACAAGCCCTCCACAAACTTCTCTAGCGTGTCCCCCGTGGTGTCCCCGACCAGGGACAGTTCGCTGGA/G delins
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1555471077
rs1555471077
1.000 0.120 16 3728772 stop gained G/C snv
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1555472938
rs1555472938
0.925 0.120 16 3736119 frameshift variant CA/- delins
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1555473122
rs1555473122
1.000 0.120 16 3736772 inframe deletion CCT/- delins
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1555483716
rs1555483716
1.000 0.120 16 3778093 frameshift variant G/- del
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1555483834
rs1555483834
0.925 0.120 16 3778699 splice donor variant C/A;T snv
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1567262537
rs1567262537
1.000 0.120 16 3729142 stop gained G/A snv
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1567263114
rs1567263114
0.925 0.120 16 3729405 frameshift variant CT/- delins
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1567269316
rs1567269316
1.000 0.120 16 3736104 stop gained T/A snv
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1567277287
rs1567277287
1.000 0.120 16 3745356 splice acceptor variant T/A snv
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1567287477
rs1567287477
1.000 0.120 16 3757906 missense variant G/C snv
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1567309482
rs1567309482
1.000 0.120 16 3782694 frameshift variant AG/- delins
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1567316655
rs1567316655
1.000 0.120 16 3792030 frameshift variant CA/- delins
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs1567318022
rs1567318022
1.000 0.120 16 3793539 frameshift variant -/T delins
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs199821421
rs199821421
0.827 0.160 16 3728723 stop gained G/A;T snv 5.2E-05
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0
dbSNP: rs200782888
rs200782888
0.925 0.120 16 3749626 splice donor variant C/G;T snv
CUI: C4551859
Disease: RUBINSTEIN-TAYBI SYNDROME 1
RUBINSTEIN-TAYBI SYNDROME 1
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Nervous System Diseases 0.700 0