CSTB, cystatin B, 1476

N. diseases: 155; N. variants: 14
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs74315443
rs74315443
1.000 0.080 21 43776260 missense variant C/A;G snv 8.0E-06
CUI: C0751785
Disease: Unverricht-Lundborg Syndrome
Unverricht-Lundborg Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.810 1.000 1 1997 1997
dbSNP: rs147484110
rs147484110
0.807 0.200 21 43774760 splice acceptor variant C/G snv 1.5E-04 2.7E-04
CUI: C0026827
Disease: Muscle hypotonia
Muscle hypotonia
Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 1.000 8 2002 2017
dbSNP: rs147484110
rs147484110
0.807 0.200 21 43774760 splice acceptor variant C/G snv 1.5E-04 2.7E-04
CUI: C0432072
Disease: Dysmorphic features
Dysmorphic features
0.700 1.000 8 2002 2017
dbSNP: rs147484110
rs147484110
0.807 0.200 21 43774760 splice acceptor variant C/G snv 1.5E-04 2.7E-04
CUI: C0751778
Disease: Myoclonic Epilepsies, Progressive
Myoclonic Epilepsies, Progressive
Nervous System Diseases 0.700 1.000 6 1996 2012
dbSNP: rs147484110
rs147484110
0.807 0.200 21 43774760 splice acceptor variant C/G snv 1.5E-04 2.7E-04
CUI: C0751785
Disease: Unverricht-Lundborg Syndrome
Unverricht-Lundborg Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 4 1996 2012
dbSNP: rs147484110
rs147484110
0.807 0.200 21 43774760 splice acceptor variant C/G snv 1.5E-04 2.7E-04
CUI: C0013384
Disease: Dyskinetic syndrome
Dyskinetic syndrome
Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 0
dbSNP: rs147484110
rs147484110
0.807 0.200 21 43774760 splice acceptor variant C/G snv 1.5E-04 2.7E-04
CUI: C0008489
Disease: Chorea
Chorea
Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 0
dbSNP: rs147484110
rs147484110
0.807 0.200 21 43774760 splice acceptor variant C/G snv 1.5E-04 2.7E-04
CUI: C1858120
Disease: Generalized hypotonia
Generalized hypotonia
Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 0
dbSNP: rs147484110
rs147484110
0.807 0.200 21 43774760 splice acceptor variant C/G snv 1.5E-04 2.7E-04
CUI: C0424503
Disease: Dysmorphic facies
Dysmorphic facies
0.700 0
dbSNP: rs147484110
rs147484110
0.807 0.200 21 43774760 splice acceptor variant C/G snv 1.5E-04 2.7E-04
CUI: C2315100
Disease: Pediatric failure to thrive
Pediatric failure to thrive
Pathological Conditions, Signs and Symptoms; Nutritional and Metabolic Diseases; Mental Disorders 0.700 0
dbSNP: rs147484110
rs147484110
0.807 0.200 21 43774760 splice acceptor variant C/G snv 1.5E-04 2.7E-04
CUI: C0557874
Disease: Global developmental delay
Global developmental delay
0.700 0
dbSNP: rs147484110
rs147484110
0.807 0.200 21 43774760 splice acceptor variant C/G snv 1.5E-04 2.7E-04
CUI: C4551563
Disease: Microcephaly (physical finding)
Microcephaly (physical finding)
0.700 0
dbSNP: rs386833440
rs386833440
1.000 0.080 21 43774658 splice region variant C/T snv
CUI: C0751785
Disease: Unverricht-Lundborg Syndrome
Unverricht-Lundborg Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 1 2002 2002
dbSNP: rs386833443
rs386833443
1.000 0.080 21 43776204 splice region variant C/T snv
CUI: C0751785
Disease: Unverricht-Lundborg Syndrome
Unverricht-Lundborg Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.710 1.000 1 2018 2018
dbSNP: rs312262708
rs312262708
1.000 0.080 21 43774677 missense variant C/T snv 1.4E-05
CUI: C0751785
Disease: Unverricht-Lundborg Syndrome
Unverricht-Lundborg Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs864309482
rs864309482
1.000 0.080 21 43774637 splice donor variant CTCCTGAGGCCCACACTCTA/TT delins
CUI: C0751785
Disease: Unverricht-Lundborg Syndrome
Unverricht-Lundborg Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs74315442
rs74315442
0.851 0.200 21 43774297 stop gained G/A snv 4.0E-05 2.1E-05
CUI: C0751785
Disease: Unverricht-Lundborg Syndrome
Unverricht-Lundborg Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.710 1.000 11 1996 2016
dbSNP: rs545986367
rs545986367
0.882 0.080 21 43774690 stop gained G/A snv 3.2E-05 7.0E-06
CUI: C0026650
Disease: Movement Disorders
Movement Disorders
Nervous System Diseases 0.700 1.000 8 2002 2017
dbSNP: rs545986367
rs545986367
0.882 0.080 21 43774690 stop gained G/A snv 3.2E-05 7.0E-06
CUI: C0432072
Disease: Dysmorphic features
Dysmorphic features
0.700 1.000 8 2002 2017
dbSNP: rs545986367
rs545986367
0.882 0.080 21 43774690 stop gained G/A snv 3.2E-05 7.0E-06
CUI: C0751778
Disease: Myoclonic Epilepsies, Progressive
Myoclonic Epilepsies, Progressive
Nervous System Diseases 0.700 1.000 3 1996 2016
dbSNP: rs74315442
rs74315442
0.851 0.200 21 43774297 stop gained G/A snv 4.0E-05 2.1E-05
CUI: C0376532
Disease: Epilepsy, Rolandic
Epilepsy, Rolandic
Nervous System Diseases 0.700 1.000 1 2018 2018
dbSNP: rs1569006250
rs1569006250
1.000 0.040 21 43776206 stop gained G/A snv
CUI: C0751778
Disease: Myoclonic Epilepsies, Progressive
Myoclonic Epilepsies, Progressive
Nervous System Diseases 0.700 0
dbSNP: rs545986367
rs545986367
0.882 0.080 21 43774690 stop gained G/A snv 3.2E-05 7.0E-06
CUI: C0751785
Disease: Unverricht-Lundborg Syndrome
Unverricht-Lundborg Syndrome
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs74315442
rs74315442
0.851 0.200 21 43774297 stop gained G/A snv 4.0E-05 2.1E-05
CUI: C0241816
Disease: Global brain atrophy
Global brain atrophy
0.700 0
dbSNP: rs74315442
rs74315442
0.851 0.200 21 43774297 stop gained G/A snv 4.0E-05 2.1E-05
CUI: C0013384
Disease: Dyskinetic syndrome
Dyskinetic syndrome
Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 0