Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs104894113
rs104894113
1.000 0.080 9 2718166 stop gained G/A;T snv
CUI: C1835897
Disease: Retinal Cone Dystrophy 3B
Retinal Cone Dystrophy 3B
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases 0.700 0
dbSNP: rs104894114
rs104894114
1.000 0.080 9 2718655 stop gained G/A;C;T snv 8.0E-06
CUI: C1835897
Disease: Retinal Cone Dystrophy 3B
Retinal Cone Dystrophy 3B
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases 0.700 0
dbSNP: rs140256288
rs140256288
1.000 0.080 9 2718181 stop gained G/A;T snv 1.2E-05; 1.2E-05
CUI: C1835897
Disease: Retinal Cone Dystrophy 3B
Retinal Cone Dystrophy 3B
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases 0.700 0
dbSNP: rs1402837406
rs1402837406
0.882 0.080 9 2718093 frameshift variant CC/-;CCC delins 2.8E-05
CUI: C1835897
Disease: Retinal Cone Dystrophy 3B
Retinal Cone Dystrophy 3B
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases 0.700 0
dbSNP: rs1554628460
rs1554628460
9 2717843 frameshift variant -/GTTCCGGCTCCCAGGCCAGCATCCACGGCTGGACAGAGGGCAACTATAACTACTACATCGAGGAAGACGAAGACGGCGAGGAGGAGGACCAGTGGAAGGACGACCTGGCAGAAGAGGACCAGCAGGCAGGGGAGGTCACCACCGCCAAGCCCGAGGGCCCCAGCGACCCTCCGGCCCTGCTGTCC delins
CUI: C0854723
Disease: Retinal Dystrophies
Retinal Dystrophies
Eye Diseases 0.700 0
dbSNP: rs387907302
rs387907302
1.000 0.080 9 2717965 stop gained C/T snv
CUI: C1835897
Disease: Retinal Cone Dystrophy 3B
Retinal Cone Dystrophy 3B
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases 0.700 0
dbSNP: rs397514604
rs397514604
1.000 0.080 9 2718230 missense variant T/C snv 4.0E-06
CUI: C1835897
Disease: Retinal Cone Dystrophy 3B
Retinal Cone Dystrophy 3B
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases 0.700 0
dbSNP: rs772921412
rs772921412
1.000 0.080 9 2718303 stop gained G/A;C snv 4.2E-06; 8.5E-06
CUI: C1835897
Disease: Retinal Cone Dystrophy 3B
Retinal Cone Dystrophy 3B
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases 0.700 0
dbSNP: rs786205064
rs786205064
1.000 0.080 9 2718746 inframe deletion ACCTGGTGG/-;ACCTGGTGGACCTGGTGG delins 3.5E-05
CUI: C1835897
Disease: Retinal Cone Dystrophy 3B
Retinal Cone Dystrophy 3B
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases 0.700 0
dbSNP: rs786205121
rs786205121
1.000 0.080 9 2717745 frameshift variant AACA/- delins
CUI: C1835897
Disease: Retinal Cone Dystrophy 3B
Retinal Cone Dystrophy 3B
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases 0.700 0
dbSNP: rs977790637
rs977790637
9 2718301 missense variant T/A;G snv
CUI: C0854723
Disease: Retinal Dystrophies
Retinal Dystrophies
Eye Diseases 0.700 0
dbSNP: rs104894115
rs104894115
1.000 0.080 9 2729465 missense variant G/A snv
CUI: C1835897
Disease: Retinal Cone Dystrophy 3B
Retinal Cone Dystrophy 3B
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases 0.800 1.000 1 2006 2006
dbSNP: rs104894116
rs104894116
1.000 0.080 9 2718506 missense variant C/G;T snv
CUI: C1835897
Disease: Retinal Cone Dystrophy 3B
Retinal Cone Dystrophy 3B
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases 0.800 1.000 1 2006 2006
dbSNP: rs776275880
rs776275880
1.000 0.080 9 2718116 missense variant T/A;C snv
CUI: C1835897
Disease: Retinal Cone Dystrophy 3B
Retinal Cone Dystrophy 3B
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases 0.700 1.000 1 2006 2006
dbSNP: rs149648640
rs149648640
0.925 0.080 9 2729470 stop gained G/A;T snv 1.3E-04; 2.0E-05
CUI: C0730290
Disease: Cone Dystrophy
Cone Dystrophy
Eye Diseases 0.010 1.000 1 2011 2011
dbSNP: rs786205121
rs786205121
1.000 0.080 9 2717745 frameshift variant AACA/- delins
CUI: C0854723
Disease: Retinal Dystrophies
Retinal Dystrophies
Eye Diseases 0.700 1.000 1 2011 2011
dbSNP: rs149648640
rs149648640
0.925 0.080 9 2729470 stop gained G/A;T snv 1.3E-04; 2.0E-05
CUI: C1835897
Disease: Retinal Cone Dystrophy 3B
Retinal Cone Dystrophy 3B
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases 0.700 1.000 5 2008 2013
dbSNP: rs1402837406
rs1402837406
0.882 0.080 9 2718093 frameshift variant CC/-;CCC delins 2.8E-05
Progressive cone dystrophy (without rod involvement)
Eye Diseases 0.700 1.000 1 2019 2019
dbSNP: rs1402837406
rs1402837406
0.882 0.080 9 2718093 frameshift variant CC/-;CCC delins 2.8E-05
CUI: C1855465
Disease: STARGARDT DISEASE 1 (disorder)
STARGARDT DISEASE 1 (disorder)
0.700 1.000 1 2019 2019