FLCN, folliculin, 201163
N. diseases: 160; N. variants: 127
Source: ALL
Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
1.000 | 0.080 | 17 | 17226323 | splice acceptor variant | C/T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 17 | 17223983 | stop gained | C/A;T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 17 | 17213858 | splice acceptor variant | T/C | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 17 | 17221629 | splice acceptor variant | C/A;G | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
0.882 | 0.160 | 17 | 17228135 | start lost | C/G | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 17 | 17222528 | stop gained | C/T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 17 | 17221555 | stop gained | G/A | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 17 | 17219206 | stop gained | A/C | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 17 | 17217147 | stop gained | C/T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 17 | 17216379 | splice donor variant | C/T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
1.000 | 0.080 | 17 | 17214991 | stop gained | C/T | snv |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 0 | |||||||||||
|
0.925 | 0.080 | 17 | 17216395 | frameshift variant | G/-;GG | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 7 | 2002 | 2015 | ||||||||
|
1.000 | 0.080 | 17 | 17215237 | frameshift variant | GA/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 6 | 2005 | 2017 | ||||||||
|
1.000 | 0.080 | 17 | 17216506 | splice region variant | GGA/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 6 | 2010 | 2017 | ||||||||
|
0.925 | 0.080 | 17 | 17224069 | inframe deletion | AAG/- | delins | 4.0E-06 | 7.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 6 | 2008 | 2017 | ||||||
|
1.000 | 0.080 | 17 | 17219188 | frameshift variant | TTCT/- | delins | 8.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 5 | 2008 | 2016 | |||||||
|
1.000 | 0.080 | 17 | 17215032 | frameshift variant | -/ACAG | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 5 | 2005 | 2015 | ||||||||
|
0.925 | 0.080 | 17 | 17219126 | frameshift variant | -/GTACTCTCTGGCAACACAGGGGCTTTCT | delins | 4.0E-05 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 3 | 2002 | 2016 | |||||||
|
1.000 | 0.080 | 17 | 17226224 | frameshift variant | -/T | delins | 4.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 3 | 2008 | 2013 | |||||||
|
1.000 | 0.080 | 17 | 17215299 | frameshift variant | C/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 2 | 2014 | 2018 | ||||||||
|
1.000 | 0.080 | 17 | 17226252 | frameshift variant | AC/GTG | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 2 | 2008 | 2011 | ||||||||
|
1.000 | 0.080 | 17 | 17216428 | frameshift variant | G/- | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 2 | 2008 | 2014 | ||||||||
|
1.000 | 0.080 | 17 | 17223956 | frameshift variant | C/- | delins | 7.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 2 | 2005 | 2008 | |||||||
|
1.000 | 0.080 | 17 | 17215282 | frameshift variant | -/GCGGCTGCGTGGACCTC | delins |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 2 | 2008 | 2010 | ||||||||
|
1.000 | 0.080 | 17 | 17219060 | frameshift variant | G/- | delins | 7.0E-06 |
|
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms | 0.700 | 1.000 | 1 | 2005 | 2005 |