IQSEC2, IQ motif and Sec7 domain ArfGEF 2, 23096

N. diseases: 155; N. variants: 33
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1057518993
rs1057518993 		1.000 0.040 X 53243367 stop gained G/A snv
CUI: C0004352
Disease: Autistic Disorder
Autistic Disorder 		Mental Disorders 0.700 0
dbSNP: rs1057520858
rs1057520858 		1.000 0.080 X 53243445 stop gained G/A snv
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1060499660
rs1060499660 		1.000 0.080 X 53248219 missense variant A/G snv
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1064795512
rs1064795512 		1.000 0.080 X 53234646 frameshift variant -/C delins
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1556858912
rs1556858912 		1.000 0.080 X 53234247 frameshift variant -/GGCCT delins
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1556859744
rs1556859744 		1.000 0.080 X 53236495 missense variant G/A;C snv
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1556863340
rs1556863340 		1.000 0.080 X 53250900 frameshift variant G/- delins
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1556863398
rs1556863398 		1.000 0.080 X 53250926 frameshift variant -/G delins
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1556863435
rs1556863435 		1.000 0.080 X 53250946 frameshift variant GCCGG/- delins
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1556863492
rs1556863492 		1.000 0.080 X 53251018 frameshift variant TAGAGGGG/- delins
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1556865060
rs1556865060 		1.000 0.080 X 53255936 frameshift variant A/- del
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1556880284
rs1556880284 		1.000 0.080 X 53320973 frameshift variant GCTGGCCCTCCAGCTCCTCGATGCGCCGCCGCTGGGTTTCCAGCAGCTGCTGCTGGCTCTCGATGATGTTGTTCAGCTCCAGCAGGTACTCCACGGC/AT delins
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1569290954
rs1569290954 		1.000 0.080 X 53234267 frameshift variant G/-;GG delins
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1569291699
rs1569291699 		1.000 0.080 X 53234869 stop gained G/A snv
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1569300277
rs1569300277 		1.000 0.080 X 53248112 splice donor variant A/G snv
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1569302816
rs1569302816 		1.000 0.080 X 53250997 stop gained G/A snv
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs1569306667
rs1569306667 		1.000 0.080 X 53256062 splice acceptor variant C/T snv
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs782460038
rs782460038 		1.000 0.080 X 53255945 frameshift variant G/- delins
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs782660318
rs782660318 		1.000 0.080 X 53255951 frameshift variant C/- delins
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs782697291
rs782697291 		X 53236409 missense variant G/A snv 4.0E-04 8.4E-05
CUI: C4021085
Disease: Abnormality of brain morphology
Abnormality of brain morphology 		0.700 0
dbSNP: rs878853144
rs878853144 		1.000 0.200 X 53239213 stop gained G/A snv
CUI: C0025362
Disease: Mental Retardation
Mental Retardation 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs1569291627
rs1569291627 		1.000 0.080 X 53234811 frameshift variant G/- delins
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 5 2010 2017
dbSNP: rs1556861311
rs1556861311 		1.000 0.080 X 53243331 splice donor variant C/T snv
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 3 2010 2016
dbSNP: rs267607186
rs267607186 		1.000 0.080 X 53247131 missense variant G/A snv
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 1.000 2 2010 2015
dbSNP: rs267607187
rs267607187 		1.000 0.080 X 53248778 missense variant T/G snv
CUI: C2931498
Disease: Mental Retardation, X-Linked 1
Mental Retardation, X-Linked 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.800 1.000 2 2010 2015