GJB2, gap junction protein beta 2, 2706
N. diseases: 392; N. variants: 132
Source: ALL
Variant | DSI v | DPI v | Chr | Position | Consequence | Alleles | Class | AF EXOME | AF GENOME | Disease | Disease Class | Score vda | EI vda | N. PMIDs | First Ref. | Last Ref. | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
0.708 | 0.440 | 13 | 20189473 | missense variant | C/A;T | snv | 7.7E-03 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.800 | 0.900 | 10 | 2004 | 2017 | |||||||
|
0.790 | 0.200 | 13 | 20189481 | missense variant | A/C;G | snv | 8.7E-03 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.740 | 0.833 | 6 | 2001 | 2012 | |||||||
|
0.752 | 0.280 | 13 | 20189031 | missense variant | C/G;T | snv | 6.0E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.730 | 0.667 | 3 | 2010 | 2017 | |||||||
|
0.882 | 0.200 | 13 | 20189359 | missense variant | G/A;C | snv |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.720 | 1.000 | 2 | 2000 | 2001 | ||||||||
|
0.695 | 0.440 | 13 | 20189313 | missense variant | A/G | snv | 6.4E-04 | 6.4E-04 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.720 | 1.000 | 2 | 2005 | 2007 | ||||||
|
0.763 | 0.280 | 13 | 20189155 | missense variant | G/A | snv | 1.2E-04 | 2.0E-04 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.720 | 1.000 | 2 | 2005 | 2019 | ||||||
|
0.672 | 0.400 | 13 | 20189511 | stop gained | C/T | snv | 5.8E-04 | 1.1E-04 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.710 | 1.000 | 1 | 2019 | 2019 | ||||||
|
0.925 | 0.120 | 13 | 20189450 | stop gained | C/G;T | snv | 2.8E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.710 | 1.000 | 1 | 2001 | 2001 | |||||||
|
1.000 | 0.120 | 13 | 20189212 | stop gained | G/A | snv | 8.4E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.710 | 1.000 | 1 | 2017 | 2017 | |||||||
|
1.000 | 0.120 | 13 | 20189526 | missense variant | C/A;G | snv | 2.8E-05; 1.2E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.710 | 1.000 | 1 | 2005 | 2005 | |||||||
|
0.776 | 0.280 | 13 | 20189443 | stop gained | C/A;T | snv | 1.3E-04; 4.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | ||||||||||
|
0.742 | 0.280 | 13 | 20189548 | missense variant | C/A;G | snv | 5.1E-04 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | ||||||||||
|
0.827 | 0.120 | 13 | 20189332 | missense variant | C/A;G;T | snv | 1.6E-05; 3.6E-05; 4.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | ||||||||||
|
0.925 | 0.120 | 13 | 20189523 | missense variant | A/G | snv |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||||
|
0.925 | 0.120 | 13 | 20189487 | missense variant | C/A;T | snv | 3.2E-05; 4.0E-06 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | ||||||||||
|
0.925 | 0.120 | 13 | 20189256 | frameshift variant | CTTGATGAACTTCC/- | delins | 1.5E-04 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | ||||||||||
|
0.763 | 0.280 | 13 | 20188965 | missense variant | T/C | snv | 9.6E-05 | 1.8E-04 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||
|
0.925 | 0.120 | 13 | 20189217 | missense variant | T/A;G | snv | 6.0E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | ||||||||||
|
1.000 | 0.120 | 13 | 20189413 | stop gained | G/A | snv | 2.8E-05 | 2.8E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||
|
0.763 | 0.280 | 13 | 20189299 | missense variant | C/T | snv | 4.8E-05 | 7.7E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||
|
1.000 | 0.120 | 13 | 20188982 | stop gained | TCCAGACAC/GAATGTCATGAACACTG | delins |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||||
|
1.000 | 0.120 | 13 | 20189284 | missense variant | G/A | snv | 1.2E-05 | 2.8E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||
|
1.000 | 0.120 | 13 | 20188976 | stop gained | -/AAATTCCAGACACTGCAATCATGAACACTGTGAAGACAGTCTTCTC | delins |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | |||||||||||
|
0.925 | 0.120 | 13 | 20189547 | missense variant | C/A;T | snv | 9.2E-05; 7.2E-05 |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 | ||||||||||
|
0.790 | 0.280 | 13 | 20189434 | missense variant | C/A;T | snv |
|
Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases | 0.700 | 0 |