HOXA13, homeobox A13, 3209

N. diseases: 126; N. variants: 7
Disease: Hand foot uterus syndrome ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs121912542
rs121912542 		1.000 0.160 7 27198251 missense variant T/G snv
CUI: C1841679
Disease: Hand foot uterus syndrome
Hand foot uterus syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.800 1.000 4 2000 2016
dbSNP: rs104894019
rs104894019 		1.000 0.160 7 27198258 stop gained C/T snv
CUI: C1841679
Disease: Hand foot uterus syndrome
Hand foot uterus syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.700 0
dbSNP: rs1158254994
rs1158254994 		1.000 0.160 7 27199671 stop gained G/A;T snv 7.4E-06
CUI: C1841679
Disease: Hand foot uterus syndrome
Hand foot uterus syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.700 0
dbSNP: rs387906542
rs387906542 		1.000 0.160 7 27199671 frameshift variant -/AGGACGACGCGGCGGCGGCGGCGGCGGCTGCAGCGGCAGCCGCGGCAGCAGC delins
CUI: C1841679
Disease: Hand foot uterus syndrome
Hand foot uterus syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Musculoskeletal Diseases; Male Urogenital Diseases 0.700 0