FAS, Fas cell surface death receptor, 355

N. diseases: 754; N. variants: 47
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs28929498
rs28929498 		0.925 0.120 10 89014221 missense variant A/T snv
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs28929498
rs28929498 		0.925 0.120 10 89014221 missense variant A/T snv
CUI: C1328840
Disease: Autoimmune Lymphoproliferative Syndrome
Autoimmune Lymphoproliferative Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs606231361
rs606231361 		1.000 0.120 10 89007732 frameshift variant G/- delins
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs606231362
rs606231362 		1.000 0.120 10 89007838 splice donor variant -/T delins
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs606231363
rs606231363 		1.000 0.120 10 89011997 splice acceptor variant A/C snv
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs606231364
rs606231364 		0.925 0.160 10 89003071 missense variant G/A snv
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs606231364
rs606231364 		0.925 0.160 10 89003071 missense variant G/A snv
CUI: C0024305
Disease: Lymphoma, Non-Hodgkin
Lymphoma, Non-Hodgkin 		Neoplasms; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs606231365
rs606231365 		1.000 0.120 10 89014409 frameshift variant -/AAAATTCAAACTTCAGAAAT delins
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs606231366
rs606231366 		1.000 0.120 10 89014134 frameshift variant -/T ins
CUI: C1866119
Disease: Autoimmune Lymphoproliferative Syndrome, Type IA
Autoimmune Lymphoproliferative Syndrome, Type IA 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs758835365
rs758835365 		1.000 0.120 10 89010795 stop gained C/T snv 8.0E-06 7.0E-06
CUI: C0024305
Disease: Lymphoma, Non-Hodgkin
Lymphoma, Non-Hodgkin 		Neoplasms; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 0
dbSNP: rs370426812
rs370426812 		0.882 0.200 10 89014312 synonymous variant G/A snv 4.0E-05 3.5E-05
CUI: C0015923
Disease: Fetal Alcohol Syndrome
Fetal Alcohol Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Chemically-Induced Disorders 0.020 1.000 2 2007 2007
dbSNP: rs1223868338
rs1223868338 		0.882 0.040 10 88990884 missense variant G/C snv 7.0E-06
CUI: C1332986
Disease: Childhood Osteosarcoma
Childhood Osteosarcoma 		Neoplasms 0.010 1.000 1 2007 2007
dbSNP: rs1223868338
rs1223868338 		0.882 0.040 10 88990884 missense variant G/C snv 7.0E-06
CUI: C0029463
Disease: Osteosarcoma
Osteosarcoma 		Neoplasms 0.010 1.000 1 2007 2007
dbSNP: rs1223868338
rs1223868338 		0.882 0.040 10 88990884 missense variant G/C snv 7.0E-06
CUI: C0585442
Disease: Osteosarcoma of bone
Osteosarcoma of bone 		Neoplasms 0.010 1.000 1 2007 2007
dbSNP: rs370426812
rs370426812 		0.882 0.200 10 89014312 synonymous variant G/A snv 4.0E-05 3.5E-05
CUI: C0546837
Disease: Malignant neoplasm of esophagus
Malignant neoplasm of esophagus 		Digestive System Diseases; Neoplasms 0.010 1.000 1 2007 2007
dbSNP: rs370426812
rs370426812 		0.882 0.200 10 89014312 synonymous variant G/A snv 4.0E-05 3.5E-05
CUI: C0014859
Disease: Esophageal Neoplasms
Esophageal Neoplasms 		Digestive System Diseases; Neoplasms 0.010 1.000 1 2007 2007
dbSNP: rs370426812
rs370426812 		0.882 0.200 10 89014312 synonymous variant G/A snv 4.0E-05 3.5E-05
CUI: C0152018
Disease: Esophageal carcinoma
Esophageal carcinoma 		Digestive System Diseases; Neoplasms 0.010 1.000 1 2007 2007
dbSNP: rs1926203
rs1926203 		0.882 0.160 10 88967577 intron variant C/A snv 0.59
CUI: C0684249
Disease: Carcinoma of lung
Carcinoma of lung 		Neoplasms; Respiratory Tract Diseases 0.700 1.000 1 2009 2009
dbSNP: rs1926203
rs1926203 		0.882 0.160 10 88967577 intron variant C/A snv 0.59
CUI: C0242379
Disease: Malignant neoplasm of lung
Malignant neoplasm of lung 		Neoplasms; Respiratory Tract Diseases 0.700 1.000 1 2009 2009
dbSNP: rs121913076
rs121913076 		0.925 0.120 10 89014163 missense variant A/C snv
CUI: C1328840
Disease: Autoimmune Lymphoproliferative Syndrome
Autoimmune Lymphoproliferative Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 1.000 13 1995 2010
dbSNP: rs121913078
rs121913078 		0.925 0.120 10 89008915 missense variant C/T snv 4.0E-06
CUI: C1328840
Disease: Autoimmune Lymphoproliferative Syndrome
Autoimmune Lymphoproliferative Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 1.000 13 1995 2010
dbSNP: rs121913079
rs121913079 		1.000 0.120 10 89014137 missense variant A/G snv
CUI: C1328840
Disease: Autoimmune Lymphoproliferative Syndrome
Autoimmune Lymphoproliferative Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 1.000 13 1995 2010
dbSNP: rs121913080
rs121913080 		0.882 0.160 10 89014191 missense variant G/C snv
CUI: C1328840
Disease: Autoimmune Lymphoproliferative Syndrome
Autoimmune Lymphoproliferative Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 1.000 13 1995 2010
dbSNP: rs121913081
rs121913081 		0.925 0.120 10 89014251 missense variant C/T snv
CUI: C1328840
Disease: Autoimmune Lymphoproliferative Syndrome
Autoimmune Lymphoproliferative Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 1.000 13 1995 2010
dbSNP: rs121913086
rs121913086 		0.925 0.120 10 89014220 missense variant G/T snv
CUI: C1328840
Disease: Autoimmune Lymphoproliferative Syndrome
Autoimmune Lymphoproliferative Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Immune System Diseases; Hemic and Lymphatic Diseases 0.700 1.000 13 1995 2010