Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs199473441
rs199473441 		1.000 0.120 11 2445099 start lost A/G;T snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs199473442
rs199473442 		1.000 0.120 11 2445103 missense variant C/G;T snv
CUI: C4551647
Disease: Long QT Syndrome 1
Long QT Syndrome 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.800 1.000 24 1996 2017
dbSNP: rs199473442
rs199473442 		1.000 0.120 11 2445103 missense variant C/G;T snv
CUI: C0151878
Disease: Prolonged QT interval
Prolonged QT interval 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs199473442
rs199473442 		1.000 0.120 11 2445103 missense variant C/G;T snv
CUI: C0039070
Disease: Syncope
Syncope 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 0
dbSNP: rs199473443
rs199473443 		1.000 0.120 11 2445117 missense variant C/T snv 1.7E-04
CUI: C4551647
Disease: Long QT Syndrome 1
Long QT Syndrome 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.800 1.000 24 1996 2017
dbSNP: rs199473444
rs199473444 		1.000 0.080 11 2445138 missense variant C/T snv
CUI: C0020538
Disease: Hypertensive disease
Hypertensive disease 		Cardiovascular Diseases 0.010 1.000 1 2007 2007
dbSNP: rs199473444
rs199473444 		1.000 0.080 11 2445138 missense variant C/T snv
CUI: C0004238
Disease: Atrial Fibrillation
Atrial Fibrillation 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.010 1.000 1 2007 2007
dbSNP: rs990778345
rs990778345 		1.000 0.120 11 2445168 missense variant C/T snv 7.2E-06
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.010 1.000 1 2013 2013
dbSNP: rs1554958043
rs1554958043 		1.000 0.120 11 2445192 stop gained A/T snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1554958045
rs1554958045 		1.000 0.080 11 2445213 stop gained G/T snv
CUI: C4551509
Disease: Jervell And Lange-Nielsen Syndrome 1
Jervell And Lange-Nielsen Syndrome 1 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 1 2017 2017
dbSNP: rs1554958045
rs1554958045 		1.000 0.080 11 2445213 stop gained G/T snv
CUI: C0151878
Disease: Prolonged QT interval
Prolonged QT interval 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 1.000 1 2017 2017
dbSNP: rs1554958045
rs1554958045 		1.000 0.080 11 2445213 stop gained G/T snv
CUI: C1384666
Disease: hearing impairment
hearing impairment 		Pathological Conditions, Signs and Symptoms; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 1 2017 2017
dbSNP: rs199473671
rs199473671 		1.000 0.120 11 2445234 missense variant G/A snv 6.0E-05 6.5E-05
CUI: C4551647
Disease: Long QT Syndrome 1
Long QT Syndrome 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 20 1996 2015
dbSNP: rs397508096
rs397508096 		1.000 0.120 11 2445251 stop gained C/G snv
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 2 2005 2009
dbSNP: rs397515877
rs397515877 		1.000 0.080 11 2445251 inframe insertion ATCGCGCCC/-;ATCGCGCCCATCGCGCCC;ATCGCGCCCATCGCGCCCATCGCGCCC delins
CUI: C1837014
Disease: Atrial Fibrillation, Familial, 3
Atrial Fibrillation, Familial, 3 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs794728563
rs794728563 		11 2445260 frameshift variant GCCCGGCGCCCCAGGTCCCGCGC/- delins
CUI: C0003811
Disease: Cardiac Arrhythmia
Cardiac Arrhythmia 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs199473446
rs199473446 		1.000 0.120 11 2445295 missense variant C/A;T snv 5.0E-05
CUI: C4551647
Disease: Long QT Syndrome 1
Long QT Syndrome 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 20 1996 2015
dbSNP: rs1060500623
rs1060500623 		1.000 0.120 11 2445295 frameshift variant C/- delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs1435990592
rs1435990592 		1.000 0.120 11 2445295 frameshift variant CGGCCGCGCCC/- delins
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs199472676
rs199472676 		1.000 0.120 11 2445315 missense variant C/A;T snv 1.5E-04
CUI: C4551647
Disease: Long QT Syndrome 1
Long QT Syndrome 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 1.000 5 2011 2017
dbSNP: rs199473447
rs199473447 		1.000 0.120 11 2445412 missense variant A/T snv
CUI: C1141890
Disease: Congenital long QT syndrome
Congenital long QT syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.010 1.000 1 2006 2006
dbSNP: rs1554958092
rs1554958092 		1.000 0.120 11 2445419 missense variant G/T snv
CUI: C4551647
Disease: Long QT Syndrome 1
Long QT Syndrome 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0
dbSNP: rs199472678
rs199472678 		0.925 0.120 11 2445430 missense variant A/G snv 8.9E-06
CUI: C0023976
Disease: Long QT Syndrome
Long QT Syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.020 1.000 2 2009 2011
dbSNP: rs199472678
rs199472678 		0.925 0.120 11 2445430 missense variant A/G snv 8.9E-06
CUI: C0741923
Disease: cardiac event
cardiac event 		0.010 1.000 1 2009 2009
dbSNP: rs199472678
rs199472678 		0.925 0.120 11 2445430 missense variant A/G snv 8.9E-06
CUI: C4551647
Disease: Long QT Syndrome 1
Long QT Syndrome 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Cardiovascular Diseases 0.700 0