Disease: Atrial Fibrillation, Familial, 3 ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs120074192
rs120074192 		0.763 0.120 11 2527959 missense variant A/G snv
CUI: C1837014
Disease: Atrial Fibrillation, Familial, 3
Atrial Fibrillation, Familial, 3 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.800 1.000 1 2003 2003
dbSNP: rs120074193
rs120074193 		0.807 0.120 11 2572870 missense variant G/A;C snv 4.0E-06
CUI: C1837014
Disease: Atrial Fibrillation, Familial, 3
Atrial Fibrillation, Familial, 3 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs12720458
rs12720458 		0.716 0.240 11 2585264 missense variant A/G snv 4.0E-05 1.4E-05
CUI: C1837014
Disease: Atrial Fibrillation, Familial, 3
Atrial Fibrillation, Familial, 3 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs17221854
rs17221854 		0.807 0.120 11 2777990 missense variant C/T snv 1.6E-05
CUI: C1837014
Disease: Atrial Fibrillation, Familial, 3
Atrial Fibrillation, Familial, 3 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs199472705
rs199472705 		0.925 0.120 11 2571345 missense variant T/C snv
CUI: C1837014
Disease: Atrial Fibrillation, Familial, 3
Atrial Fibrillation, Familial, 3 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs199472708
rs199472708 		0.882 0.080 11 2572015 missense variant G/A snv
CUI: C1837014
Disease: Atrial Fibrillation, Familial, 3
Atrial Fibrillation, Familial, 3 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs199472709
rs199472709 		0.790 0.120 11 2572021 missense variant G/A;T snv
CUI: C1837014
Disease: Atrial Fibrillation, Familial, 3
Atrial Fibrillation, Familial, 3 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs199472795
rs199472795 		0.807 0.120 11 2775984 missense variant C/T snv 7.0E-06
CUI: C1837014
Disease: Atrial Fibrillation, Familial, 3
Atrial Fibrillation, Familial, 3 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs397508097
rs397508097 		0.807 0.120 11 2768917 stop gained C/T snv 2.8E-05 1.4E-05
CUI: C1837014
Disease: Atrial Fibrillation, Familial, 3
Atrial Fibrillation, Familial, 3 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0
dbSNP: rs397515877
rs397515877 		1.000 0.080 11 2445251 inframe insertion ATCGCGCCC/-;ATCGCGCCCATCGCGCCC;ATCGCGCCCATCGCGCCCATCGCGCCC delins
CUI: C1837014
Disease: Atrial Fibrillation, Familial, 3
Atrial Fibrillation, Familial, 3 		Pathological Conditions, Signs and Symptoms; Cardiovascular Diseases 0.700 0