SMAD4, SMAD family member 4, 4089

N. diseases: 575; N. variants: 144
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1568211187
rs1568211187 		1.000 0.120 18 51076670 frameshift variant AGCAGCAGGCGGCTACTGCACAAGC/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 5 1997 2012
dbSNP: rs397518413
rs397518413 		0.882 0.400 18 51078294 missense variant C/T snv 8.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 5 2014 2014
dbSNP: rs281875324
rs281875324 		1.000 0.120 18 51065456 missense variant A/C;G snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 4 2002 2012
dbSNP: rs1555685248
rs1555685248 		1.000 0.120 18 51049326 splice donor variant T/C snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 3 2005 2012
dbSNP: rs1555686086
rs1555686086 		1.000 0.120 18 51059916 splice donor variant G/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 3 2005 2012
dbSNP: rs1555687377
rs1555687377 		1.000 0.120 18 51076637 splice acceptor variant G/A snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 3 2005 2012
dbSNP: rs1568208715
rs1568208715 		1.000 0.120 18 51067017 splice acceptor variant A/C snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 3 2005 2012
dbSNP: rs397518413
rs397518413 		0.882 0.400 18 51078294 missense variant C/T snv 8.0E-06
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 3 2014 2014
dbSNP: rs587781618
rs587781618 		1.000 0.120 18 51067188 splice donor variant G/A;T snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 3 2005 2012
dbSNP: rs876660556
rs876660556 		18 51065555 missense variant G/A;C snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 3 2007 2013
dbSNP: rs1060500740
rs1060500740 		1.000 0.120 18 51076778 splice donor variant T/C snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 2 2006 2012
dbSNP: rs121912581
rs121912581 		0.925 0.200 18 51065521 missense variant G/A snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 2 1998 2002
dbSNP: rs377767326
rs377767326 		1.000 0.120 18 51048839 stop gained C/T snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 2 2006 2007
dbSNP: rs377767334
rs377767334 		0.925 0.200 18 51058143 frameshift variant -/G delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 2 1998 2010
dbSNP: rs1057519962
rs1057519962 		0.827 0.160 18 51067035 missense variant G/A;T snv
CUI: C0278701
Disease: Gastric Adenocarcinoma
Gastric Adenocarcinoma 		Digestive System Diseases; Neoplasms 0.700 1.000 1 2016 2016
dbSNP: rs1057519962
rs1057519962 		0.827 0.160 18 51067035 missense variant G/A;T snv
CUI: C0152013
Disease: Adenocarcinoma of lung (disorder)
Adenocarcinoma of lung (disorder) 		Neoplasms 0.700 1.000 1 2016 2016
dbSNP: rs1057519962
rs1057519962 		0.827 0.160 18 51067035 missense variant G/A;T snv
CUI: C0009404
Disease: Colorectal Neoplasms
Colorectal Neoplasms 		Digestive System Diseases; Neoplasms 0.700 1.000 1 2016 2016
dbSNP: rs1057519962
rs1057519962 		0.827 0.160 18 51067035 missense variant G/A;T snv
CUI: C0152018
Disease: Esophageal carcinoma
Esophageal carcinoma 		Digestive System Diseases; Neoplasms 0.700 1.000 1 2016 2016
dbSNP: rs1057519962
rs1057519962 		0.827 0.160 18 51067035 missense variant G/A;T snv
CUI: C0007112
Disease: Adenocarcinoma of prostate
Adenocarcinoma of prostate 		Neoplasms; Male Urogenital Diseases 0.700 1.000 1 2016 2016
dbSNP: rs1057519962
rs1057519962 		0.827 0.160 18 51067035 missense variant G/A;T snv
CUI: C0281361
Disease: Adenocarcinoma of pancreas
Adenocarcinoma of pancreas 		Digestive System Diseases; Neoplasms; Endocrine System Diseases 0.700 1.000 1 2016 2016
dbSNP: rs1060500733
rs1060500733 		1.000 0.120 18 51065563 stop gained C/T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 1 2014 2014
dbSNP: rs1060500744
rs1060500744 		1.000 0.120 18 51078334 frameshift variant G/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 1 2008 2008
dbSNP: rs11875522
rs11875522 		18 51065392 intron variant G/A snv 1.1E-02 4.8E-02
CUI: C0392885
Disease: High density lipoprotein measurement
High density lipoprotein measurement 		0.700 1.000 1 2012 2012
dbSNP: rs11875522
rs11875522 		18 51065392 intron variant G/A snv 1.1E-02 4.8E-02
CUI: C0428472
Disease: Serum HDL cholesterol measurement
Serum HDL cholesterol measurement 		0.700 1.000 1 2012 2012
dbSNP: rs121912580
rs121912580 		0.807 0.280 18 51067036 missense variant G/A;C;T snv
CUI: C0152013
Disease: Adenocarcinoma of lung (disorder)
Adenocarcinoma of lung (disorder) 		Neoplasms 0.700 1.000 1 2016 2016