SMAD4, SMAD family member 4, 4089

N. diseases: 575; N. variants: 144
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1555687572
rs1555687572 		1.000 0.120 18 51078331 missense variant G/A snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs864622252
rs864622252 		1.000 0.120 18 51078320 frameshift variant T/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs281875320
rs281875320 		1.000 0.320 18 51078308 missense variant A/G snv
CUI: C0796081
Disease: Myhre syndrome
Myhre syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Male Urogenital Diseases; Nervous System Diseases; Endocrine System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.800 1.000 2 2011 2012
dbSNP: rs281875321
rs281875321 		0.925 0.360 18 51078307 missense variant T/C snv
CUI: C0796081
Disease: Myhre syndrome
Myhre syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Male Urogenital Diseases; Nervous System Diseases; Endocrine System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.800 1.000 2 2011 2012
dbSNP: rs281875321
rs281875321 		0.925 0.360 18 51078307 missense variant T/C snv
CUI: C0035334
Disease: Retinitis Pigmentosa
Retinitis Pigmentosa 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases 0.010 1.000 1 2012 2012
dbSNP: rs281875321
rs281875321 		0.925 0.360 18 51078307 missense variant T/C snv
CUI: C0730362
Disease: Disorder of macula of retina
Disorder of macula of retina 		Eye Diseases 0.010 1.000 1 2012 2012
dbSNP: rs281875322
rs281875322 		0.807 0.480 18 51078306 missense variant A/G snv 4.0E-06
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 7 2011 2016
dbSNP: rs281875322
rs281875322 		0.807 0.480 18 51078306 missense variant A/G snv 4.0E-06
CUI: C0796081
Disease: Myhre syndrome
Myhre syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Male Urogenital Diseases; Nervous System Diseases; Endocrine System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.820 1.000 4 2011 2020
dbSNP: rs281875322
rs281875322 		0.807 0.480 18 51078306 missense variant A/G snv 4.0E-06
CUI: C0152427
Disease: Polydactyly
Polydactyly 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases 0.010 1.000 1 2020 2020
dbSNP: rs281875322
rs281875322 		0.807 0.480 18 51078306 missense variant A/G snv 4.0E-06
CUI: C0034013
Disease: Precocious Puberty
Precocious Puberty 		Endocrine System Diseases 0.010 1.000 1 2020 2020
dbSNP: rs281875322
rs281875322 		0.807 0.480 18 51078306 missense variant A/G snv 4.0E-06
CUI: C1832942
Disease: JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder)
JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder) 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs281875322
rs281875322 		0.807 0.480 18 51078306 missense variant A/G snv 4.0E-06
CUI: C0235974
Disease: Pancreatic carcinoma
Pancreatic carcinoma 		Digestive System Diseases; Neoplasms; Endocrine System Diseases 0.700 0
dbSNP: rs397518413
rs397518413 		0.882 0.400 18 51078294 missense variant C/T snv 8.0E-06
CUI: C0432072
Disease: Dysmorphic features
Dysmorphic features 		0.700 1.000 13 2004 2016
dbSNP: rs397518413
rs397518413 		0.882 0.400 18 51078294 missense variant C/T snv 8.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 1.000 5 2014 2014
dbSNP: rs397518413
rs397518413 		0.882 0.400 18 51078294 missense variant C/T snv 8.0E-06
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 3 2014 2014
dbSNP: rs397518413
rs397518413 		0.882 0.400 18 51078294 missense variant C/T snv 8.0E-06
CUI: C0796081
Disease: Myhre syndrome
Myhre syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Male Urogenital Diseases; Nervous System Diseases; Endocrine System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.710 1.000 3 2014 2019
dbSNP: rs377767368
rs377767368 		1.000 0.120 18 51078286 missense variant A/C snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs121912578
rs121912578 		1.000 0.120 18 51078285 missense variant G/C snv
CUI: C0235974
Disease: Pancreatic carcinoma
Pancreatic carcinoma 		Digestive System Diseases; Neoplasms; Endocrine System Diseases 0.800 0
dbSNP: rs377767367
rs377767367 		1.000 0.120 18 51078280 missense variant G/T snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs1060500740
rs1060500740 		1.000 0.120 18 51076778 splice donor variant T/C snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 2 2006 2012
dbSNP: rs377767387
rs377767387 		1.000 0.160 18 51076777 splice donor variant G/A snv
CUI: C1832942
Disease: JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder)
JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder) 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs377767366
rs377767366 		1.000 0.120 18 51076750 frameshift variant C/- del
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs1555687388
rs1555687388 		18 51076746 frameshift variant G/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs377767365
rs377767365 		1.000 0.120 18 51076740 frameshift variant GGCCCAGGATCAGTAGGTGGAATAG/- del
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767364
rs377767364 		1.000 0.120 18 51076738 frameshift variant -/CCCT ins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0