SMAD4, SMAD family member 4, 4089

N. diseases: 575; N. variants: 144
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs377767336
rs377767336 		1.000 0.120 18 51058379 frameshift variant AC/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767338
rs377767338 		1.000 0.120 18 51059884 frameshift variant -/GCAT delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767340
rs377767340 		1.000 0.120 18 51065438 frameshift variant G/- del
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767341
rs377767341 		1.000 0.120 18 51065447 frameshift variant -/T delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767343
rs377767343 		1.000 0.120 18 51065502 frameshift variant C/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767344
rs377767344 		1.000 0.120 18 51065508 frameshift variant GT/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767345
rs377767345 		1.000 0.160 18 51065522 missense variant G/A snv
CUI: C1832942
Disease: JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder)
JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder) 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs377767346
rs377767346 		1.000 0.120 18 51065525 missense variant A/C;G snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767347
rs377767347 		0.742 0.520 18 51065549 missense variant G/A;C;T snv
CUI: C0235974
Disease: Pancreatic carcinoma
Pancreatic carcinoma 		Digestive System Diseases; Neoplasms; Endocrine System Diseases 0.700 0
dbSNP: rs377767347
rs377767347 		0.742 0.520 18 51065549 missense variant G/A;C;T snv
CUI: C0796081
Disease: Myhre syndrome
Myhre syndrome 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Musculoskeletal Diseases; Male Urogenital Diseases; Nervous System Diseases; Endocrine System Diseases; Mental Disorders; Behavior and Behavior Mechanisms 0.700 0
dbSNP: rs377767347
rs377767347 		0.742 0.520 18 51065549 missense variant G/A;C;T snv
CUI: C0009402
Disease: Colorectal Carcinoma
Colorectal Carcinoma 		Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767347
rs377767347 		0.742 0.520 18 51065549 missense variant G/A;C;T snv
CUI: C1832942
Disease: JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder)
JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder) 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs377767348
rs377767348 		1.000 0.120 18 51065554 missense variant T/C snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767349
rs377767349 		1.000 0.160 18 51065553 inframe deletion GTT/- delins
CUI: C1832942
Disease: JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder)
JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder) 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs377767351
rs377767351 		1.000 0.160 18 51065566 frameshift variant TC/- delins
CUI: C1832942
Disease: JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder)
JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder) 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs377767352
rs377767352 		1.000 0.120 18 51065580 frameshift variant C/- del
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767354
rs377767354 		1.000 0.120 18 51065607 splice donor variant G/A snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767355
rs377767355 		1.000 0.160 18 51067027 missense variant T/A;C snv
CUI: C1832942
Disease: JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder)
JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder) 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs377767356
rs377767356 		1.000 0.120 18 51067047 missense variant G/A snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767357
rs377767357 		1.000 0.120 18 51067072 stop gained G/A snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767359
rs377767359 		1.000 0.120 18 51067146 frameshift variant G/- delins
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767360
rs377767360 		0.882 0.240 18 51076662 stop gained C/T snv 4.0E-06
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767360
rs377767360 		0.882 0.240 18 51076662 stop gained C/T snv 4.0E-06
CUI: C1832942
Disease: JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder)
JUVENILE POLYPOSIS/HEREDITARY HEMORRHAGIC TELANGIECTASIA SYNDROME (disorder) 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Hemic and Lymphatic Diseases; Cardiovascular Diseases 0.700 0
dbSNP: rs377767361
rs377767361 		1.000 0.120 18 51076671 stop gained C/T snv
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs377767362
rs377767362 		1.000 0.120 18 51076672 frameshift variant AGCAGCAGGCGGCTACTGCACAA/- del
CUI: C0345893
Disease: Juvenile polyposis syndrome
Juvenile polyposis syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0