MECP2, methyl-CpG binding protein 2, 4204

N. diseases: 90; N. variants: 362
Disease: Angelman Syndrome ×
Source: CURATED ×
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1557135251
rs1557135251 		1.000 0.080 X 154030618 splice acceptor variant GGCTGGTGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGG/- delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs267608426
rs267608426 		0.882 0.080 X 154032473 frameshift variant TCTT/- delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs267608434
rs267608434 		0.925 0.080 X 154032416 frameshift variant GG/- delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs28934904
rs28934904 		0.776 0.200 X 154031431 missense variant G/A;C;T snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs28934906
rs28934906 		0.716 0.320 X 154031355 missense variant G/A snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs28935468
rs28935468 		0.732 0.240 X 154030912 missense variant G/A snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs61748396
rs61748396 		0.882 0.080 X 154031405 stop gained G/C;T snv
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs61750241
rs61750241 		0.807 0.080 X 154031022 frameshift variant C/- delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0
dbSNP: rs63749748
rs63749748 		0.882 0.080 X 154030628 splice acceptor variant TGGGGTCCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGG/- delins
CUI: C0162635
Disease: Angelman Syndrome
Angelman Syndrome 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nervous System Diseases 0.700 0