MECP2, methyl-CpG binding protein 2, 4204

N. diseases: 664; N. variants: 387
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs267608327
rs267608327
0.763 0.200 X 154030631 splice acceptor variant CCTCGGAGCTCTCGGGCTCAGGTGGAGGTGGGGGCAGGGGT/- delins
CUI: C0542223
Disease: Loss of speech
Loss of speech
Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 0
dbSNP: rs28934906
rs28934906
0.716 0.320 X 154031355 missense variant G/A snv
CUI: C0542223
Disease: Loss of speech
Loss of speech
Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 0
dbSNP: rs61750240
rs61750240
0.752 0.240 X 154031020 stop gained G/A;C snv 5.5E-06
CUI: C0542223
Disease: Loss of speech
Loss of speech
Pathological Conditions, Signs and Symptoms; Nervous System Diseases 0.700 0