Disease: Bare Lymphocyte Syndrome, Type II, Complementation Group A ×
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs137852602
rs137852602 		1.000 0.120 16 10906633 stop gained G/T snv
CUI: C1859534
Disease: Bare Lymphocyte Syndrome, Type II, Complementation Group A
Bare Lymphocyte Syndrome, Type II, Complementation Group A 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 0
dbSNP: rs1555507411
rs1555507411 		1.000 0.120 16 10915570 splice donor variant CTGGGCCCTGTCTCAGGCCCCCAGGCTTTCCCCAAACTGGTGCGGATCCTCACGGCCTTTTCCTCCCTGCAGCATCTGGAG/- delins
CUI: C1859534
Disease: Bare Lymphocyte Syndrome, Type II, Complementation Group A
Bare Lymphocyte Syndrome, Type II, Complementation Group A 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 0
dbSNP: rs771073292
rs771073292 		1.000 0.120 16 10922491 splice donor variant G/A snv 1.2E-05 7.0E-06
CUI: C1859534
Disease: Bare Lymphocyte Syndrome, Type II, Complementation Group A
Bare Lymphocyte Syndrome, Type II, Complementation Group A 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 0
dbSNP: rs863223293
rs863223293 		1.000 0.120 16 10907555 stop gained G/A snv
CUI: C1859534
Disease: Bare Lymphocyte Syndrome, Type II, Complementation Group A
Bare Lymphocyte Syndrome, Type II, Complementation Group A 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Immune System Diseases 0.700 0