Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs370124822
rs370124822
1.000 0.120 1 45333513 stop gained G/A;C snv 7.0E-06
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs376561094
rs376561094
1.000 0.120 1 45332636 stop gained G/A snv 4.0E-06 7.0E-06
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs558173961
rs558173961
1.000 0.120 1 45332049 stop gained G/A;T snv 1.2E-05 7.0E-06
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs587780088
rs587780088
0.882 0.120 1 45334493 stop gained G/A;C snv 8.0E-06; 4.0E-06
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs587781704
rs587781704
1.000 0.120 1 45334457 frameshift variant C/- del 2.0E-05
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs587782730
rs587782730
1.000 0.120 1 45332916 splice donor variant A/C;G snv 4.0E-06
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs746449748
rs746449748
0.925 0.120 1 45333561 splice acceptor variant C/- delins 1.6E-05
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs766420907
rs766420907
1.000 0.120 1 45331503 stop gained G/A snv 6.0E-05
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs768386527
rs768386527
1.000 0.120 1 45334463 stop gained G/A snv 4.0E-06 7.0E-06
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs786202133
rs786202133
1.000 0.120 1 45331316 missense variant G/C snv
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs786203115
rs786203115
0.925 0.120 1 45332300 stop gained G/A snv 1.6E-05
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs786203213
rs786203213
1.000 0.120 1 45333315 frameshift variant C/- del 4.0E-06
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs863224452
rs863224452
1.000 0.120 1 45333172 splice acceptor variant T/C snv
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs863224501
rs863224501
0.925 0.160 1 45331519 frameshift variant TCACGGACGGG/- delins 2.1E-05
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs863224502
rs863224502
0.882 0.160 1 45331184 stop gained T/A snv 1.4E-05
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs876660787
rs876660787
1.000 0.120 1 45332959 stop gained T/A snv 4.0E-06
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs878854189
rs878854189
1.000 0.120 1 45333427 frameshift variant -/T delins
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 0
dbSNP: rs372267274
rs372267274
0.882 0.120 1 45333171 splice acceptor variant C/G;T snv
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 11 1987 2014
dbSNP: rs587780082
rs587780082
0.925 0.120 1 45331835 stop gained G/A snv 8.2E-05 3.5E-05
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 5 1990 2014
dbSNP: rs1553125766
rs1553125766
1.000 0.120 1 45331474 frameshift variant TTC/G delins
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 10 1998 2015
dbSNP: rs768130289
rs768130289
1.000 0.120 1 45331746 frameshift variant GG/-;G;GGG delins
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 11 2001 2015
dbSNP: rs1553123017
rs1553123017
1.000 0.120 1 45329405 frameshift variant -/AC delins
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 4 2001 2015
dbSNP: rs878854186
rs878854186
1.000 0.120 1 45329404 frameshift variant T/- del
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 4 2001 2015
dbSNP: rs1553126848
rs1553126848
1.000 0.120 1 45331801 frameshift variant GCTCCGAGGGAGGCAGGCACAGG/- delins
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.700 1.000 2 2001 2015
dbSNP: rs36053993
rs36053993
0.677 0.280 1 45331556 missense variant C/T snv 3.0E-03 3.3E-03
Colorectal Adenomatous Polyposis, Autosomal Recessive
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Digestive System Diseases; Neoplasms 0.800 1.000 43 2002 2016