GPR143, G protein-coupled receptor 143, 4935

N. diseases: 47; N. variants: 29
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1057518787
rs1057518787
0.925 0.200 X 9765782 frameshift variant CAGCAGAAGGTCCCTAGGCGCGGGG/- delins
CUI: C0078917
Disease: Albinism, Ocular
Albinism, Ocular
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Nutritional and Metabolic Diseases; Eye Diseases; Skin and Connective Tissue Diseases 0.700 0