MKS1, MKS transition zone complex subunit 1, 54903

N. diseases: 231; N. variants: 57
Source: ALL
Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1114167302
rs1114167302 		0.925 0.320 17 58216687 missense variant C/A snv
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.010 1.000 1 2016 2016
dbSNP: rs2302313
rs2302313 		0.925 0.080 17 58205665 3 prime UTR variant G/A snv 9.2E-02 8.3E-02
CUI: C0699790
Disease: Colon Carcinoma
Colon Carcinoma 		Digestive System Diseases; Neoplasms 0.010 1.000 1 2012 2012
dbSNP: rs2302313
rs2302313 		0.925 0.080 17 58205665 3 prime UTR variant G/A snv 9.2E-02 8.3E-02
CUI: C0007102
Disease: Malignant tumor of colon
Malignant tumor of colon 		Digestive System Diseases; Neoplasms 0.010 1.000 1 2012 2012
dbSNP: rs886044605
rs886044605 		1.000 0.320 17 58216174 missense variant T/C;G snv 4.0E-06
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.010 < 0.001 1 2011 2011
dbSNP: rs386834048
rs386834048 		0.827 0.320 17 58216088 splice region variant C/T snv 1.3E-04 1.3E-04
CUI: C0265215
Disease: Meckel-Gruber syndrome
Meckel-Gruber syndrome 		Pathological Conditions, Signs and Symptoms 0.700 1.000 7 2007 2017
dbSNP: rs386834043
rs386834043 		0.851 0.320 17 58206553 splice region variant ATGCCATTGGGACAGCCTCAGGTTTCTGC/- delins 1.3E-03
CUI: C0431399
Disease: Familial aplasia of the vermis
Familial aplasia of the vermis 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases 0.700 1.000 6 2006 2016
dbSNP: rs386834048
rs386834048 		0.827 0.320 17 58216088 splice region variant C/T snv 1.3E-04 1.3E-04
CUI: C0431399
Disease: Familial aplasia of the vermis
Familial aplasia of the vermis 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases 0.700 1.000 6 2007 2017
dbSNP: rs386834043
rs386834043 		0.851 0.320 17 58206553 splice region variant ATGCCATTGGGACAGCCTCAGGTTTCTGC/- delins 1.3E-03
CUI: C0265215
Disease: Meckel-Gruber syndrome
Meckel-Gruber syndrome 		Pathological Conditions, Signs and Symptoms 0.700 1.000 5 2006 2007
dbSNP: rs386834048
rs386834048 		0.827 0.320 17 58216088 splice region variant C/T snv 1.3E-04 1.3E-04
CUI: C2673873
Disease: BARDET-BIEDL SYNDROME 13
BARDET-BIEDL SYNDROME 13 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases 0.700 1.000 4 2007 2015
dbSNP: rs386834048
rs386834048 		0.827 0.320 17 58216088 splice region variant C/T snv 1.3E-04 1.3E-04
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 4 2007 2015
dbSNP: rs386834048
rs386834048 		0.827 0.320 17 58216088 splice region variant C/T snv 1.3E-04 1.3E-04
CUI: C4310705
Disease: JOUBERT SYNDROME 28
JOUBERT SYNDROME 28 		0.700 1.000 4 2007 2015
dbSNP: rs201845154
rs201845154 		1.000 0.320 17 58214760 missense variant G/A snv 1.8E-04 3.4E-04
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 3 2006 2016
dbSNP: rs754279998
rs754279998 		0.776 0.360 17 58208153 inframe deletion GAG/- delins 2.0E-05 1.4E-05
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 3 2014 2016
dbSNP: rs754279998
rs754279998 		0.776 0.360 17 58208153 inframe deletion GAG/- delins 2.0E-05 1.4E-05
CUI: C4310705
Disease: JOUBERT SYNDROME 28
JOUBERT SYNDROME 28 		0.700 1.000 3 2014 2016
dbSNP: rs754279998
rs754279998 		0.776 0.360 17 58208153 inframe deletion GAG/- delins 2.0E-05 1.4E-05
CUI: C0265215
Disease: Meckel-Gruber syndrome
Meckel-Gruber syndrome 		Pathological Conditions, Signs and Symptoms 0.700 1.000 3 2014 2016
dbSNP: rs754279998
rs754279998 		0.776 0.360 17 58208153 inframe deletion GAG/- delins 2.0E-05 1.4E-05
CUI: C2673873
Disease: BARDET-BIEDL SYNDROME 13
BARDET-BIEDL SYNDROME 13 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Eye Diseases; Nervous System Diseases 0.700 1.000 3 2014 2016
dbSNP: rs754279998
rs754279998 		0.776 0.360 17 58208153 inframe deletion GAG/- delins 2.0E-05 1.4E-05
CUI: C0431399
Disease: Familial aplasia of the vermis
Familial aplasia of the vermis 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases 0.700 1.000 3 2014 2016
dbSNP: rs863225205
rs863225205 		0.925 0.320 17 58219176 missense variant C/A snv
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 3 2006 2016
dbSNP: rs863225208
rs863225208 		0.925 0.320 17 58210988 missense variant C/T snv
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 3 2006 2016
dbSNP: rs863225210
rs863225210 		0.925 0.320 17 58207906 missense variant G/A snv
CUI: C3714506
Disease: Meckel syndrome type 1
Meckel syndrome type 1 		Pathological Conditions, Signs and Symptoms; Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases; Respiratory Tract Diseases; Nervous System Diseases; Otorhinolaryngologic Diseases 0.700 1.000 3 2006 2016
dbSNP: rs386834043
rs386834043 		0.851 0.320 17 58206553 splice region variant ATGCCATTGGGACAGCCTCAGGTTTCTGC/- delins 1.3E-03
CUI: C4310705
Disease: JOUBERT SYNDROME 28
JOUBERT SYNDROME 28 		0.700 1.000 2 2006 2012
dbSNP: rs762668200
rs762668200 		0.882 0.320 17 58206543 splice acceptor variant -/C delins 6.5E-05 7.0E-06
CUI: C0431399
Disease: Familial aplasia of the vermis
Familial aplasia of the vermis 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases 0.700 1.000 2 2007 2007
dbSNP: rs762668200
rs762668200 		0.882 0.320 17 58206543 splice acceptor variant -/C delins 6.5E-05 7.0E-06
CUI: C0265215
Disease: Meckel-Gruber syndrome
Meckel-Gruber syndrome 		Pathological Conditions, Signs and Symptoms 0.700 1.000 2 2007 2007
dbSNP: rs1114167302
rs1114167302 		0.925 0.320 17 58216687 missense variant C/A snv
CUI: C0431399
Disease: Familial aplasia of the vermis
Familial aplasia of the vermis 		Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Female Urogenital Diseases and Pregnancy Complications; Eye Diseases; Male Urogenital Diseases 0.700 1.000 1 2016 2016
dbSNP: rs111786708
rs111786708 		1.000 0.040 17 58211816 intron variant T/C snv 4.2E-03
CUI: C3548479
Disease: response to bronchodilator
response to bronchodilator 		0.700 1.000 1 2015 2015