Variant DSI v DPI v Chr Position Consequence Alleles Class AF EXOME AF GENOME Disease Disease Class Score vda EI vda N. PMIDs First Ref. Last Ref.
dbSNP: rs1553628410
rs1553628410
2 214809469 frameshift variant -/A delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1553628445
rs1553628445
2 214809501 frameshift variant -/ACGAGGCTCGTTCCCGGAGCGGA delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1559371635
rs1559371635
2 214728742 frameshift variant C/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1559372682
rs1559372682
2 214728993 frameshift variant -/AA delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1559424302
rs1559424302
2 214780874 frameshift variant -/A delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1559424634
rs1559424634
2 214780970 stop gained T/A snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1559437094
rs1559437094
2 214792389 stop gained C/T snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs1559437198
rs1559437198
2 214792414 missense variant A/G snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs377153250
rs377153250
2 214780658 stop gained G/A;C snv 1.6E-05; 4.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs587780035
rs587780035
2 214781165 stop gained G/A;C;T snv 7.8E-05; 4.6E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs587780037
rs587780037
2 214809491 stop gained C/A;G snv 1.3E-05 2.1E-05
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs587781430
rs587781430
1.000 0.080 2 214781141 stop gained G/A snv 4.7E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs587781671
rs587781671
2 214781214 frameshift variant AAAT/- delins
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs587781728
rs587781728
2 214780927 stop gained A/C snv
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs587782504
rs587782504
2 214730479 frameshift variant TA/- delins 7.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs587782897
rs587782897
2 214745152 frameshift variant AT/- del 7.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs747446711
rs747446711
2 214745084 stop gained C/A;T snv 4.0E-06; 4.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs751710099
rs751710099
2 214745127 stop gained G/A;C snv 4.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs752514155
rs752514155
2 214809515 stop gained C/A;G;T snv 2.8E-05; 4.6E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs753785671
rs753785671
1.000 0.080 2 214780559 splice donor variant C/T snv 4.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs761702998
rs761702998
2 214769289 stop gained G/A;C;T snv 8.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs762601855
rs762601855
2 214729009 splice acceptor variant C/G;T snv 4.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs767587416
rs767587416
2 214769298 frameshift variant A/- del 4.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs768490891
rs768490891
2 214730410 splice donor variant C/A;G;T snv 4.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0
dbSNP: rs772486760
rs772486760
1.000 0.080 2 214781413 frameshift variant -/TCTT delins 4.0E-06 7.0E-06
CUI: C0027672
Disease: Neoplastic Syndromes, Hereditary
Neoplastic Syndromes, Hereditary
Congenital, Hereditary, and Neonatal Diseases and Abnormalities; Neoplasms 0.700 0